We narrowed to 17,821 results for: Por
-
Plasmid#192892PurposeHDR donor for inserting FOXL2-T2A-tdTomato reporterDepositorInsertFOXL2-tdTomato (FOXL2 Human)
UseCRISPRMutationT2A-tdTomato fluorescent reporterPromoterPGKAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-FGFR1c-V5/HIS
Plasmid#201106Purposeexpression of human FGFR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman FGFR1 receptor tyrosine kinase, variant c, full length, wildtype (FGFR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-LAMP1-HaloTag
Plasmid#164209PurposeExpresses HaloTag tagged LAMP1 under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP13A2 WT
Plasmid#171485Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A2 WTDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-MFSD2B_STOP
Plasmid#161435PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertMFSD2B (MFSD2B Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC35F6
Plasmid#132073PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35F6 (C2orf18 Human)
ExpressionMammalianAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKT2/CAGXSP/CD63mScarlet
Plasmid#182972PurposeStably express CD63 fused with mScarlet in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-Fzd4 subtype NGS Wnt
Plasmid#159625PurposeExpress Fzd4 subtype NGS Wnt in mammalian cellsDepositorInsertFzd4 subtype NGS Wnt
UseLentiviralTagsHis tagExpressionMammalianAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE-K2N
Plasmid#154879PurposeEpisomally expresses KLF2 and NANOG in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE-KdGl
Plasmid#154880PurposeEpisomally expresses KDM4D and GLIS1 in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-iSeroSnFR
Plasmid#128484PurposeFluorescent reporter for serotonin (mammalian expression, membrane localization tag)DepositorInsertiSeroSnFR
TagsIg-kappa leader, Myc, PDGFR + enhanced ER export,…ExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-Basigin_iso2
Plasmid#221416PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertBasigin_iso2 (BSG Human)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
IL2Ralpha-pEGFP-FKBP
Plasmid#251430PurposeMammalian expression vector for expressing the human interleukin-2 receptor alpha subunit (IL2Ralpha membrane anchor) fused to EGFP and FKBP at the C-terminusDepositorAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-Sec61b WPRE
Plasmid#236228PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to mEmerald.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC4A11_STOP
Plasmid#161358PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC4A11 (SLC4A11 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-GCaMP5G
Plasmid#31788Purposea single-wavelength GCaMP3-based calcium indicator with improved response. Please also see the GCaMP6s/m/f indicators.DepositorInsertGCaMP5G
Tags6xHis, T7 epitope, and Xpress tagExpressionMammalianPromoterCMVAvailable SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only