We narrowed to 15,910 results for: grna
-
Plasmid#98972PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNA targeting hLMNA. Generates breaks with 44bp 5' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(D10A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable sinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC73
Plasmid#62341PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: GAATAGCTCAGAGGCC…PromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAL10
Plasmid#236006PurposeBackbone for assembling gRNA arrays with LacZ gene for blue white screeningDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianAvailable sinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV_A2S-8
Plasmid#188654PurposeAAV vector expressing SaAID-2S and gRNADepositorPublicationInsertsAID2S--nSaCas9-UGI
Sa-sgRNA
UseAAV and CRISPRTagsUGIExpressionMammalianMutationD10A for SaCas9PromoterScp1 and U6Available sinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO-ADE1
Plasmid#120264PurposepDYSCKO canavanine co-selection vector with a guide targeting the ADE1 locusDepositorInsertpDYSCKO cassette-ADE1 targeting guide
UseCRISPR and Synthetic BiologyPromoterSNR52Available sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDYSCKO
Plasmid#120263PurposeEmpty backbone for cloning any gRNA to be used with the canavanine co-selection systemDepositorInsertDYSCKO cassette
UseCRISPR and Synthetic BiologyPromoterSNR52Available sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry TFRC_B
Plasmid#78544PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDECKO-mCherry MALAT1_Exon.4
Plasmid#78543PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.2
Plasmid#78541PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable sinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
LCV2_EGFP
Plasmid#155098PurposeLentiviral backbone for cloning and expression of U6 driven gRNAs with Esp3I/BsmBI cloning sites, puromycin selection and EGFP expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRISPR-Cas9/CD4-TK2
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorAvailable sinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLRK36
Plasmid#253105PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting NAC21/22 genes in wheatDepositorPublicationInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available sinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLRK57
Plasmid#253106PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting DWF4 genes in wheatDepositorPublicationInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available sinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLRK35
Plasmid#253104PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting DND2 genes in wheatDepositorPublicationInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available sinceApril 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVID
Plasmid#236635PurposeCRISPR cloning, gRNA expression, and detection of undesired vector insertion during HDR for DrosophilaDepositorTypeEmpty backboneUseCRISPRPromoterdU6:3Available sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
HSF1 KO
Plasmid#200207PurposegRNA for HSF1 KODepositorAvailable sinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only