We narrowed to 2,015 results for: D10
-
Plasmid#24417PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Plasmid also known as pEntR3L2 TetO-mCh-Rs1.DepositorInsertRs1
UseGateway CloningTagsFLAG and mCherry-P2AMutationD100APromotershort TetO, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-EDAR-Fc(DAPA)-AviTag-6xHis
Plasmid#156554PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertEDAR (EDAR Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFP5380 LAMP1-SBP- mCherry-FIREtag
Plasmid#216725PurposeExpresses LAMP1-mCherry-FIREtag in mamallian cellsDepositorInsertLAMP-1 (LAMP1 Human)
TagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVhyg
Plasmid#134323PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-LAMP1
Plasmid#207788PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the LAMP1 locus. For lysosome visualization.To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a moxGFP-Puro Cassette (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-mA1-BE3
Plasmid#113421PurposeExpresses mA1-BE3 in mammalian cellsDepositorInsertmA1-BE3 (Apobec1 Mouse, S. pyogenes and Bacteriophage PBS2)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Unc5b.a-Fc-His
Plasmid#72178PurposeExpresses the extracellular region of the Unc5B, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
EC2_10_dCas9_VPR_HC_sgRNA
Plasmid#163712PurposeYeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC2_4_dCas9_VPR_sgRNA
Plasmid#163709PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pST1374-GCN4-dCas9
Plasmid#113023PurposeExpresses GCN4-dCas9 in mammalian cellsDepositorInsertGCN4-dCas9 (GCN4 Budding Yeast, S. pyogenes)
ExpressionMammalianMutationD10A, D839A, H840A, N863APromoterCMVAvailable SinceJuly 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_SBP-EGFP-LAMP2
Plasmid#222321PurposeSynchronize the trafficking of LAMP2 from the ER.DepositorInsertStreptavidin-KDEL and LAMP2 fused to SBP-EGFP (LAMP2 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-CAD
Plasmid#73567PurposeSoluble activator of Orai1 channelsDepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTagBFP-C1-FKBP-PIP5K1C-HD-EE
Plasmid#220090PurposeRecruitable PIP5K to make PIP2DepositorInsertPIP5K1C (PIP5K1C Human)
TagsTagBFP-FKBP1A(3-108)ExpressionMammalianMutationamino acids 1-635; D101R, R304D, R445E, K446EPromoterCMVAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-VCAM1-Fc(DAPA)-AviTag-6xHis
Plasmid#156942PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertVCAM1 (VCAM1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only