We narrowed to 8,680 results for: sgRNA
-
Plasmid#70679PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
SauCas9KKH CCR5-nicking sgRNA
Plasmid#169863PurposeSauCas9KKH nicking sgRNA for CCR5DepositorInsertSauCas9KKH CCR5-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM117: VEGFA array presgRNA
Plasmid#166869PurposeU6-driven expression of human VEGFA targeting array presgRNA compatible with CasRx.DepositorInsertHuman VEGFA targeting array presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNArodA
Plasmid#149656Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Sa sgRNA expression vector
Plasmid#107720PurposeFor in vitro transcription of Sa sgRNA from the T7 promoter.DepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 2
Plasmid#70660PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A2T
Plasmid#62258Purposeexpression of A2T sgRNA from the arabinose-inducible promoterDepositorInsertA2T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cas9 ROSA sgRNA mCherry
Plasmid#155280PurposeLentiviral Cas9 expression, ROSA sgRNA expression, mCherry markerDepositorInsertspCas9
Available SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Eif4a1-L
Plasmid#122346PurposeExpresses sgRNA targeting mouse Eif4a1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Eif4a1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF820_U6-sgRNA-EF1a-mCherry2_lenti
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-LRTM2
Plasmid#69237PurposeU6 driven SpCas9 sgRNA expression for LRTM2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-mini-sgRNA
Plasmid#246934Purposefor HEK293T human cell genome editingDepositorInsertLaTranC mini-sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only