We narrowed to 7,002 results for: tet
-
Plasmid#190811PurposeExpress APOE E2 allele from tet-inducible promoter, co-expressing Puro resistance geneDepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pETduet+sfGFP-TetR
Plasmid#157794PurposeExpression of sfGFP-TetR fusion proteinDepositorInsertsfGFP-TetR
TagsHis6ExpressionBacterialPromoterT7Available SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKC059_pLVX_TetON_TmEnc
Plasmid#242115PurposeTet- or Dox-inducible expression of TmEncDepositorInsertTmEnc
UseLentiviralPromoterTRE3GSAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-betaCatenin
Plasmid#114281PurposeTET-inducible expression of a constitutively active form of the BetaCatenin proteinDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-rtTA-IN
Plasmid#60612PurposeBackbone for tet-inducible genesDepositorTypeEmpty backboneAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR58.6
Plasmid#63176PurposeExpresses CcaR constitutively and sfGFP under the PcpcG2-172 promoterDepositorInsertsCcaR
sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceMarch 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2-UTY-F
Plasmid#17439PurposeExpression of UTY in mammalian cellsDepositorAvailable SinceFeb. 19, 2008AvailabilityAcademic Institutions and Nonprofits only -
G384A_pLenti-TetBattP(GT)-BFP-2A-iCasp9-2A-Blast_rtTA3
Plasmid#200630PurposeNegative selection blasticidin resistant Tet-inducible Matreyek Bxb1(GT) landing padDepositorInsertiCasp9
UseLentiviralPromoterpTRE3GAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-tTRKRAB
Plasmid#12249DepositorInsertTetR-KRAB fusion
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
-
pNTI661 pRPR1(TetO)-sgRNA
Plasmid#139475PurposeVector for tet-regulated sgRNA expression in yeastDepositorInsertsingle guide RNA scaffold
UseCRISPRExpressionYeastPromoterpRPR1(TetO)Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR358.4
Plasmid#125114PurposeExpression of narL(1-159aa)-liaR(154-211aa) chimera under PLtetO-1, output Promoter PliaI121DepositorInsertsnarL(REC)-liaR(DBD)159
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-pT3-tetR-sfGFP
Plasmid#140871PurposeT3 promoter driven synthesis of TetR-sfGFPDepositorInsertTetR-sfGFP expressed with T3 promoter
UseSynthetic BiologyTagssfGFPExpressionBacterialPromoterT3Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2-UTX-F-MT2
Plasmid#40619PurposeExpression of enzyme-dead UTX in mammalian cellsDepositorInsertUTX (KDM6A Human)
Tags6xMyc and FlagExpressionMammalianMutationchanged Histidine 1146 and Glutamic Acid 1148 to …PromoterCMVAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
rTetR-GFP-VP16
Plasmid#183917PurposeVP16 activation domain coupled to reverse Tet repressor; labeled with GFP; binds tetO sites upon doxycycline additionDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBI-MCS-EYFP
Plasmid#58855PurposeThe tet-responsive reporter pBI-MCS-EGFP (Addgene plasmid 16542) was modified to express YFP instead of GFPDepositorInsertenhanced yellow fluorescent protein
ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSHDY-PL03-mVenus_tetR
Plasmid#137663PurposeConjugative vector derived from pSHDY. Constitutive expression of the repressor tetR, as well as aTc-inducible expression of mVenus.DepositorInsertPL03:mVenus
ExpressionBacterialPromoterPL03Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBB328
Plasmid#221533PurposePlasmid for the introduction of Mariner transposon that inserts deoxyviolacein cassette behind indigenous promoters in target bacterial strain. Plasmid has tetracycline marker for selection.DepositorInsertsvioABCE
Mariner transposase and transposon backbone from pBB298 (originally from pEB001)
Tetracycline antibiotic cassette from pRK415
ExpressionBacterialPromoterNone, contains RBS siteAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only