We narrowed to 21,484 results for: SPR
-
Plasmid#176665PurposeExpression of sgRNA under D. melanogaster U6-2 _(_CR32867) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
PX458_ZNF146_1
Plasmid#72360PurposeEncodes gRNA for 3' target of human ZNF146 along with Cas9 with 2A GFPDepositorInsertZNF146 (ZNF146 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_AT
Plasmid#196243PurposeBackbone plasmid for cloning sgRNADepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterJ23119Available SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE-R-hyg
Plasmid#222826PurposeCRISPR/Cas9 for multi-gene knockout in Arabidopsis (EC1 promoter, hygromycin and red fluorescent seed selection)DepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE-R-bar5A9si
Plasmid#222837PurposeCRISPR/Cas9 for multi-gene knockout in Arabidopsis (single intron-containing Cas9, RPS5A promoter, bialaphos and red fluorescent seed selection)DepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCM4.4
Plasmid#217648Purposean ermE*p-cas9-driven expression, as an alternative plasmidDepositorInsertCodon Optimized SpCas9
UseCRISPRAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSI-356 v2
Plasmid#158431PurposeSpCas9 sgRNA cloning backboneDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterHuman H6Available SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCF525-AcrIIA15_gb79_Cand27_lenti
Plasmid#138313PurposeLenti expression of AcrIIA15DepositorInsertAcrIIA15
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF525-AcrIIA14_gb77_Cand9_lenti
Plasmid#138311PurposeLenti expression of AcrIIA14DepositorInsertAcrIIA14
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
TV_ANXA1-p2a-mScarlet-nls-p2a-icasp9_pgk-blast
Plasmid#251171PurposeTargeting vector for C-terminal knockin at ANXA1 locus to enable reporting of expression by mScarlet and depletion of positive cells with iCasp9.DepositorInsertp2a-mScarlet-nls-icasp9_pgk-blast flanked by homology arms for C-terminal targeting of human ANXA1 (ANXA1 Human)
UseCRISPRTagsp2a-mScarlet-nls-p2a-icasp9Available SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
TV_EMP1-ires-mNeon-nls-p2a-icasp9-wpre_pgk-puro
Plasmid#251175PurposeTargeting vector for C-terminal knockin at EMP1 locus to enable reporting of expression by mNeonGreen and depletion of positive cells with iCasp9DepositorInsertires-mNeon-nls-p2a-icasp9-wpre_pgk-puro flanked by homology arms for C-terminal targeting of human EMP1
UseCRISPRTagsires-mNeon-nls-p2a-icasp9Available SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLex307-UCOE-SFFV-puroR-MCP-HSF1-VIRF2
Plasmid#218557PurposeEncodes SFFV promoter-driven MCP-HSF1-VIRF2 with an N-terminal bipartite SV40 NLS, along with puromycin resistanceDepositorInsertMCP-HSF1-VIRF2
UseLentiviralTagsSV40NLSExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…Available SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
peSCBE3-NG
Plasmid#218163PurposeThis plasmid harbors the base editor eSCBE3-NG along with an sgRNA cloning cassette, facilitating high-efficiency cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsescbe3-NG
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutation in the portion of deaminase hAPOBEC3A : …PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAD-5PSD95-EGFP-SynPhRFP
Plasmid#217979PurposeG-Deleted Rabies genomic plasmid to express 5PSD95-EGFP and SynPhRFPDepositorUseG-deleted rabiesTagsEGFP and RFPPromoterNoneAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgRANGAP.C1-CAG-Cas9-T2A-mCherry-P2A-Puro
Plasmid#216249PurposeExpress Cas9 with CAG promoter to improve the expression in hES cells and sgRANGAP.C1 to tag endogenous RANGAP1 C-terminusDepositorInsertCas9 and sgRANGAP.C1 (RANGAP1 Human)
UseCRISPR; Endogenous taggingExpressionMammalianPromoterCAGAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-SaKKH-spA-miniU6-miniSdd6-MmHPD-T2
Plasmid#204852PurposeAAV vector for cytosine base editing using miniSdd6 at HPD-T2 target site in mouseDepositorInsertminiSdd6-nSaCas9KKH(D10A)-UGI
UseAAV and CRISPRMutationD10A, E782K, N968K, R1015H in SaCas9PromoterEFS, miniU6Available SinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLY59_TRAC-LHA-pAAV-EFS-CD22BBz-PRODH2(stop)-TRAC-RHA(3166mut)
Plasmid#192189PurposeCD22 CAR AAV vector PRODH2(StopCtrl) (pLY059)DepositorInsertCD22 CAR AAV vector PRODH2(StopCtrl) (pLY059) (CD22 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only