We narrowed to 28,451 results for: Tat
-
Plasmid#102748PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationS449F (TCC > TTC)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
A435S EPHA3 pcDNA3.1
Plasmid#102747PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationA435S (GCT > TCT)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
N379K EPHA3 pcDNA3.1
Plasmid#102745PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationN379K (AAT > AAG)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
T166N EPHA3 pcDNA3.1
Plasmid#102742PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationT166N (ACT > AAT)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
D806N EPHA3 pcDNA3.1
Plasmid#102754PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationD806N (GAT > aAT)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
K761N EPHA3 pcDNA3.1
Plasmid#102752PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationK761N (AAG > AAt)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
R728L EPHA3 pcDNA3.1
Plasmid#102751PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationR728 (CGA > CtA)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
T37K EPHA3 pcDNA3.1
Plasmid#102740PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationT37K (ACA > AAA)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
N85S EPHA3 pcDNA3.1
Plasmid#102741PurposeExpression of EPHA3 in mammalian cellsDepositorInsertEPHA3 (EPHA3 Human)
Tagsmyc-6xhisExpressionMammalianMutationN85S (AAC > AGC)PromoterCMVAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.27
Plasmid#99362PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.27.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationGlutamic acid 129 to LysinePromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN171
Plasmid#91600PurposeExpress sgRNA targeting human DLGAP1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-N[80]A
Plasmid#96992PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-2B-Nkx2-5YRD Y-A
Plasmid#98611PurposeGateway entry vector for NKX2-5 YRD Y-ADepositorInsertNKX2-5 YRD Y-A (Nkx2-5 Mouse)
UseEntry vectorMutationSubstitutions of 7 tyr into Ala residues.Y233A; Y…Available SinceAug. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pet151D-TOPO-BROX 1-411; K141E
Plasmid#89865PurposeExpresses full length human BROX with mutation K141E in bacteria; internal ID WISP11-299DepositorInsertBROX (BROX Human)
TagsHis Tag, V5 tagExpressionBacterialMutationmutated lysine 141 to glutamic acidPromoterT7Available SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pet151D-TOPO-BROX 1-411; L212D
Plasmid#89864PurposeExpresses full length human BROX with mutation L212D in bacteria; internal ID WISP11-300DepositorInsertBROX (BROX Human)
TagsHis Tag, V5 tagExpressionBacterialMutationmutated leucine 212 to aspartic acidPromoterT7Available SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-Notch1 3'UTR-mir200c-mut
Plasmid#84596PurposeRenilla Luciferase reporter assay for NOTCH1 3'UTR with mutations on miR-200c binding siteDepositorInsertNOTCH1 3'UTR (NOTCH1 Human)
UseLuciferaseTagsRenilla LuciferaseMutationMutation on miR-200c binding site on NOTCH1 3…PromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-LFNG 3'UTR-mir200c-mut
Plasmid#84594PurposeRenilla Luciferase reporter assay for LFNG 3'UTR with mutations on miR-200c binding siteDepositorInsertLFNG 3'UTR (LFNG Human)
UseLuciferaseTagsRenilla LuciferaseMutationMutation on miR-200c binding site on LFNG 3'…PromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PCK2 gRNA (BRDN0001145460)
Plasmid#78080Purpose3rd generation lentiviral gRNA plasmid targeting human PCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only