We narrowed to 11,947 results for: 110
-
Plasmid#228577PurposeExpresses mouse TMEM16F-I521A-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521A plus a 3 amino acid N-terminal truncation (…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521E-peGFP-N1
Plasmid#228578PurposeExpresses mouse TMEM16F-I521E-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521E plus a 3 amino acid N-terminal truncation (…Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-EED-2A-mTurquoise
Plasmid#225692PurposeLentiviral expression of rTetR(SE) fused to EED and mTurquoise-NLSDepositorInsertrTetR-EED (EED Synthetic, Human)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-HP1a-2A-mTurquoise
Plasmid#225691PurposeLentiviral expression of rTetR(SE) fused to HP1a and mTurquoise-NLSDepositorInsertHP1a (CBX5 Synthetic, Human)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3a.H2B-K120C
Plasmid#224706PurposeExpresses Human H2B K120C mutant in bacterial cells for fluorescent labelling of histone octamersDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-LCB3_v1.2-PDGFR-T2A-mCherry (pZYW049)
Plasmid#194232PurposeLentiviral expression vector expressing LCB3 on the cell surface attached to PDGFR's transmembrane domain and mCherry transduction markerDepositorInsertEF1a-LCB3-PDGFR TMD-T2A-mCherry
UseLentiviralPromoterEF1aAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3*flag-NEXN
Plasmid#216834Purposeexpressing Falg tag and the coding sequence of mouse NexnDepositorAvailable SinceAug. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Zmynd8-exon minimal CMV pCDNA5
Plasmid#212078PurposeLR vector for integration of Zmynd8-exon into N2a FRT rtTA3 expression cellsDepositorInsertZmynd8-exon (Zmynd8 Mouse)
ExpressionMammalianAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas9-RPT6-FLAG
Plasmid#205416PurposeExpresses dCas9-RPT6 with FLAG labelDepositorAvailable SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP Cav2.2 W391A pRK5
Plasmid#206084Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a mutation (W391A) in the ?1-interacting domain (AID) in the I-II loop of Cav2.2 that prevents Beta subunit bindingDepositorAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cav2.2 HA W391A pcDNA3
Plasmid#206071Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and a mutation (W391A) in the ?1-interacting domain (AID) in the I-II loop of Cav2.2DepositorAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA8
Plasmid#196103PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196106, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA15
Plasmid#199587PurposeContains guide RNA to 5' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA16
Plasmid#199588PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_EZH2gRNA17
Plasmid#199589PurposeContains guide RNA to 3' end of mouse EZH2 geneDepositorAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hNRG1a
Plasmid#199235PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot1-5xmut-dsRNAres_U
Plasmid#147707PurposeInsect Expression of DmNot1-5xmut-dsRNAresDepositorInsertDmNot1-5xmut-dsRNAres (Not1 Fly)
ExpressionInsectMutation10 silent mutations and two non silent N605S, K75…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot1-6x mut-dsRNAres_U
Plasmid#147708PurposeInsect Expression of DmNot1-6xmut-dsRNAresDepositorInsertDmNot1-6xmut-dsRNAres (Not1 Fly)
ExpressionInsectMutation10 silent mutations and two non silent N605S, K75…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only