We narrowed to 1,922 results for: cas9 expression vector
-
Plasmid#202560PurposeE. coli cloning vector with large MCS (50+ unique restriction sites)DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pMLS236
Plasmid#73684PurposeSapTrap 3-site Destination vector for internal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormMutationPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS235
Plasmid#73683PurposeSapTrap 3-site Destination vector for C-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsExpressionWormMutationPromoterAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_HR_Prnp_3
Plasmid#78621PurposepX330 vector encoding SpCas9 and a chimeric guide RNA targeting Prnp coding sequenceDepositorInsertpX330_HR_Prnp_3
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
L1p6_barley_sgRNA_scaffold
Plasmid#231033PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 6DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRTagsExpressionBacterialMutationPromoterTaU6Available sinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p5_barley_sgRNA_scaffold
Plasmid#231032PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 5DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRTagsExpressionBacterialMutationPromoterTaU6Available sinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p4_barley_sgRNA_scaffold
Plasmid#231031PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 4DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRTagsExpressionBacterialMutationPromoterTaU6Available sinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
L1p3_barley_sgRNA_scaffold
Plasmid#231030PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 3DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRTagsExpressionBacterialMutationPromoterTaU6Available sinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-SAM
Plasmid#102559PurposePiggybac transposon vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex.DepositorInsertsMS2-P65-HSF1_T2A_Hygro
dCAS9(D10A, N863A)-VP64_T2A_Blast
UseCRISPR; Piggybac transposonTagsExpressionMammalianMutationD10A and N863A in Cas9 and N55K in MS2PromoterCAG and EF1AAvailable sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
c3GIC9n
Plasmid#62192Purposecol1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9n (D10A variant) expression. Contains NsiI cloning site for U6-sgRNA cassettesDepositorInserthumanized S. Pyogenes Cas9 (D10A)
UseCRISPRTagsHAExpressionMutationD10A substitution (Cas9n)PromoterTRE3GAvailable sinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-5sgRNA
Plasmid#64243Purposedestination vector for five U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pGGDestTol2LC-4sgRNA
Plasmid#64242Purposedestination vector for four U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-2sgRNA
Plasmid#64240Purposedestination vector for two U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-3sgRNA
Plasmid#64241Purposedestination vector for three U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-1sgRNA
Plasmid#64239Purposedestination vector for one U6x:sgRNA cassetteDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCfB3405
Plasmid#106166PurposeEasyCloneYALI system-based yeast episomal vector carrying a nourseothricin-resistance marker for Yarrowia lipolytica, can be used for gRNA expression, amp resistanceDepositorTypeEmpty backboneUseTagsExpressionYeastMutationPromoterAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only