We narrowed to 10,815 results for: ESP
-
Plasmid#87112Purposeminicircle parental backbone plasmid including GFP knock-in donor targeting Tubb3 gene and one cutting site for HITIDepositorInsertGFP
UseCRISPRAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-EGR1
Plasmid#52724Purposeretroviral expression of human EGR1DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 blast OFF 3xflag IREB2
Plasmid#169889PurposeExpress 3x flag IREB2, suppressible by doxycycline additionDepositorInsertIREB2 (IREB2 Human)
UseLentiviral; Doxycycline mediated suppressionTags3x FlagExpressionMammalianMutationSilent mutations in sgIREB2_1 and sgIREB2_2 targe…PromoterTREAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
TERT - R865C
Plasmid#213926PurposeExpresses Mutant TERT R865CDepositorInsertMutant TERT R865C (TERT Human)
UseLentiviralTags6x His TagExpressionMammalianMutationArginine 865 changed to CysteinePromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_epegRNA_entry-mpknot_(LM1140)
Plasmid#228253PurposepU6 entry plamid for cloning prime editor mpknot epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertmpknot entry plasmid backbone for epegRNA expression via human U6 promoter
ExpressionMammalianMutationn/aPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD9
Plasmid#247322PurposeThis plasmid can be used to quantify CD9 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hHelios-IRES-GFP
Plasmid#74047Purposeretroviral plasmid for expression of FLAG-tagged human Helios (IKZF2) corresponding to cDNA from NM_001079526.1DepositorInserthuman Helios (IKZF2) (IKZF2 )
UseRetroviralTagsFLAGExpressionMammalianMutationencodes shorter version of human HeliosPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEN113 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26
Plasmid#86233PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Neomycine selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-GsCT
Plasmid#205516PurposeEndosome-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertendo-GsCT (GNAS Human, Synthetic)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAC-VIOL
Plasmid#53087PurposeProduces the carotenoid violaxanthin in E. coli.DepositorInsertzep (ABA1 Mustard Weed)
UseLow copy number bacterial cloning vectorMutationLacks codons for the first 60 N-terminal amino ac…PromoterT7Available SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hIKAROS-IRES-GFP
Plasmid#74046Purposeretroviral plasmid for expression of FLAG-tagged human Ikaros corresponding to cDNA from XM_011515058.1DepositorInserthuman Ikaros (IKZF1) (IKZF1 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAi14-GFPNLS-MC
Plasmid#87114Purposeminicircle parental backbone plasmid including GFPNLS-pA knock-in donor and one cutting site for HITIDepositorInsertGFPNLSPpA
UseCRISPRPromoternEFAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-nuc-GsCT
Plasmid#205517PurposeNuclear-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertnuc-GsCT (GNAS Human, Synthetic)
TagsHistone H2A and mCherryExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN395 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE targeting
Plasmid#92141PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-YFP
Plasmid#55781PurposeThis G protein alpha-s construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-s-EE YFP (Gnas Rat)
TagsEYFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationMet was substituted for Gln69 in EYFP (Clontech).…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only