We narrowed to 1,976 results for: cas9 expression vector
-
Plasmid#231030PurposeCloning vector to clone sgRNA in scaffold under TaU6 promoter for Cas9 mediated CRISPR for goldengate level1 position 3DepositorInsertScaffold for Cas9 mediated CRISPR
UseCRISPRExpressionBacterialPromoterTaU6Available SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-SAM
Plasmid#102559PurposePiggybac transposon vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex.DepositorInsertsMS2-P65-HSF1_T2A_Hygro
dCAS9(D10A, N863A)-VP64_T2A_Blast
UseCRISPR; Piggybac transposonExpressionMammalianMutationD10A and N863A in Cas9 and N55K in MS2PromoterCAG and EF1AAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
c3GIC9n
Plasmid#62192Purposecol1a1 targeting vector for inducible [TRE3G]-GFP-IRES-Cas9n (D10A variant) expression. Contains NsiI cloning site for U6-sgRNA cassettesDepositorInserthumanized S. Pyogenes Cas9 (D10A)
UseCRISPRTagsHAMutationD10A substitution (Cas9n)PromoterTRE3GAvailable SinceAug. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pCfB3405
Plasmid#106166PurposeEasyCloneYALI system-based yeast episomal vector carrying a nourseothricin-resistance marker for Yarrowia lipolytica, can be used for gRNA expression, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL193
Plasmid#180471PurposeFor expression of Cas9 and gRNAs, multiple gRNAs cloning vectorDepositorTypeEmpty backboneUseCRISPRTagsCas9ExpressionPlantAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJin-278
Plasmid#125714PurposeABA-inducible split T7 GFP vector using RNAPN d5-19DepositorInsertPT7-GFP mRNA expression, PYL-linker-T7 RNAPC, T7 RNAPN (d5-19)-linker-ABI
ExpressionMammalianAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGMF6
Plasmid#242208Purpose35Sp::eGFP:35St cassette in L1 vector backbone. Expresses a nuclear localized eGFP protein for transient plant transformation.DepositorInsertLevel1 35Sp::eGFP:35St
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHSE401
Plasmid#62201PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKSE401
Plasmid#62202PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Kan resistanceDepositorInsertsgRNA scaffold
zCas9
UsePlant binary vectorTags3x FLAG and NLSExpressionPlantMutationmaize codon optimizedPromoter35S and AtU6-26pAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eGFP-mPlum-HA
Plasmid#200009PurposeDonor vector with double fluorescence system for targeted integration using CRISPR/Cas9. Expresses 5´HA--eGFP&PuroR--3´HA--mPlum. Distinguish targeted from random integration by fluorescence.DepositorInserteGFP, mPlum
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pECNUS4
Plasmid#184887PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only