We narrowed to 8,896 results for: sgRNA
-
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1T
Plasmid#62256Purposeexpression of A1T sgRNA from the arabinose-inducible promoterDepositorInsertA1T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-LRTM2
Plasmid#69237PurposeU6 driven SpCas9 sgRNA expression for LRTM2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
px458-Cas9 UPF1 sgRNA
Plasmid#251491PurposeCas9 CRISPR gRNA construct; expresses human UPF1 gRNADepositorInsertUPF1 gRNA
ExpressionBacterialAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-mini-sgRNA
Plasmid#246934Purposefor HEK293T human cell genome editingDepositorInsertLaTranC mini-sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_UPF3A/UPF3B (pAVA3129)
Plasmid#239329PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting UPF3A and UPF3BDepositorInsertU6-driven sgRNA1 targting UPF3A and 7SK-driven sgRNA2 targeting UPF3B (UPF3B Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3500)
Plasmid#239237PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3547)
Plasmid#239240PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
ExpressionMammalianAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3555)
Plasmid#239242PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP24 (pAVA3563)
Plasmid#239258PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP24DepositorInsertU6-driven sgRNA targeting RMP24
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA-RMP64 (pAVA3572)
Plasmid#239259PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting RMP64DepositorInsertU6-driven sgRNA targeting RMP64
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs-RMRP (pAVA3583)
Plasmid#239260PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RMRPDepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RMRP
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only