We narrowed to 28,953 results for: Tat
-
Plasmid#196518PurposeExpression of Ctdnep1_D67E-GFPDepositorInsertCtdnep1_D67EsiR (CTDNEP1 Human)
TagseGFPExpressionMammalianMutationD67E mutation (phosphastase dead). Silent mutatio…PromoterCMV promoter; T7 promoterAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSUMO-HsSyx3
Plasmid#179288PurposeE. coli expression plasmid (T7 promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + SUMO + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + SUMO + TEV protease cleavage siteExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-MFAP2
Plasmid#185555PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting MFAP2DepositorInsertMFAP2 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Flag-Avi-ires-CHD5
Plasmid#68878PurposeTransient mammalian expression of CHD5 for BirA taggingDepositorAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II tension sensor (FL-based)
Plasmid#118721PurposeThe FL-based human desmoplakin II tension sensor detects forces in the range of 3-5 pN by changes in FRET between YPet(short) and mCherry.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherryExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
mOrange-P2A-hKvb1
Plasmid#154084PurposeIndependent expression of mOrange and human Kvbeta 1 under human synapsin 1 promoterDepositorInsertmOrange-P2A-human Kvb1 (KCNAB1 Synthetic, Human)
UseAAVExpressionMammalianPromoterhuman synapsin 1Available SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG CMV14 / BRAF-D594V
Plasmid#131715PurposeMammalian Expression of Flag tagged BRAFDepositorAvailable SinceMay 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLIK mCh-V5-NES-EGFP-ERBB2 NLS zeo
Plasmid#192338PurposeLentiviral expression vector for an inducible mCh-V5-NES-EGFP-ERBB2 NLSDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-DEUT RUVBL1 Delete
Plasmid#159144PurposeExpression and protien purification of mutated RUVBL1DepositorInsertRUVBL1 (RUVBL1 Human)
ExpressionBacterialMutationamino acid 1-463, Glu134-Glu237 mutated to GPPGAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-Smad2
Plasmid#89827PurposeKnockdown human Smad2 expression in human mammalian cellsDepositorInsertSMAD2 shRNA (SMAD2 Human)
UseRetroviralAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW/TOPO-ELK3
Plasmid#98622PurposeGateway entry TOPO TA cloning vector for ELK3DepositorAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tom20-mChF-AIP(TE)
Plasmid#61522PurposeExpression of human FK506 binding protein 1A (FKBP1A) tagged with mCherry, Tom20, and AIP with TE mutationDepositorInsertFK506 binding protein 1A (FKBP1A Human)
TagsAIP with TE mutation (see comments), Tom20, and m…ExpressionMammalianPromoterCMVAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_1
Plasmid#155077PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV TIP60 212-364
Plasmid#78795PurposeTo overexpress TIP60 212-364 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(mA)-luc
Plasmid#12421DepositorInsertM-CSF receptor promoter fragment (CSF1R Human)
UseLuciferaseMutationC/EBP binding site mutation (created a KpnI site …Available SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_SNORD27h_2ntmut
Plasmid#73067Purposeexpression clone for human mutated SNORD27 (C/D box snoRNA U27)DepositorInsertSNORD27 (E2F7 Human)
Tagsno tagExpressionMammalianMutation2 nt mutation in AS box that binds E2F7 pre-mRNAAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLPC-L647RLaminA-CS
Plasmid#69062Purposeencodes a lamin A mutant with Leucine 647 mutated to an Arginin and with a substitution of cysteine in CaaX-motif by a serineDepositorInsertLaminA (LMNA Human)
UseRetroviralExpressionMammalianMutationLamin A with Leucine 647 mutated to Arginine and …PromoterCMVAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-0455
Plasmid#115463PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only