We narrowed to 14,203 results for: cas9
-
Plasmid#108283PurposeDonor vector for creation of PhiC31 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertPhiC31 attP sites
UseCRISPRAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_2
Plasmid#104049PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNFIA_iso1 gRNA (NFIA Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_NFIA_iso1_1
Plasmid#104048PurposeEncodes gRNA for 3' target of human NFIA_iso1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNFIA_iso1 gRNA (NFIA Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RXRB_1
Plasmid#104050PurposeEncodes gRNA for 3' target of human RXRB along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRXRB gRNA (RXRB Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
SOX17-3'gRNA
Plasmid#210465PurposegRNA targeting SOX17 3' terminal for CRISPR-Cas9-mediated knock-inDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSOX17 (SOX17 Human)
UseCRISPRAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT2_1
Plasmid#106308PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralExpressionMammalianAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEn-C1.1
Plasmid#61479PurposeEncodes CRISPR sgRNA for Gateway or conventional cloning of 1-3 sgRNAs into pDe-CAS9 or pCAS9-TPCDepositorInsertAtU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT1_1
Plasmid#106311PurposeExpress Cas9 and sgRNA targeting SHMT1DepositorInsertsgRNA targeting SHMT1
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable sinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgPREX1
Plasmid#86127PurposeLentiviral vector expressing Cas9 and an sgRNA targeting PREX1DepositorAvailable sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pODN-mR2-ACTB
Plasmid#183868PurposeRepair template for the N-terminal tagging of beta-actin with mRuby2 in human cells using CRISPR/Cas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertACTB homology arms with mRuby2-linker (ACTB Human)
UseCRISPR; Donor templateTagsmRuby2-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_CELF2
Plasmid#106102PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting CELF2DepositorInsertgRNA targeting CELF2 (CELF2 Human)
UseCRISPRAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA TIAL1
UseCRISPRAvailable sinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#1
Plasmid#174150PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable sinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ACTB-C4
Plasmid#229849PurposeExpresses wild-type Cas9 and gRNA for ACTB gene. The target sequence is changed from ACTB-C1 to improve the cut efficiency.DepositorInsertguide RNA for ACTB gene
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Chr1q_Centromere-Targeting_gRNA
Plasmid#195125PurposegRNA targeting centromere-proximal location on Chromosome 1q in a third generation Cas9 backbone with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChr1q gRNA
ExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PE_CO-Mini-C
Plasmid#190337PurposeExpressing the C-terminal of PE_CO-Mini using Rma intein and Cas9 673-674 split site, and pegRNA for PCSK9 +1A insertionDepositorInsertPE_CO-Mini-C, PCSK9 +1A insertion pegRNA
UseAAVAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only