We narrowed to 28,485 results for: tat
-
Plasmid#214911Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationR272Q substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-E80K
Plasmid#214910Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationE80K substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-80-GFP
Plasmid#205182PurposeExpresses chimeric rat CENP-O with mouse CENP-O N-terminus; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O N terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-203-GFP
Plasmid#205183PurposeExpresses chimeric rat CENP-O with mouse CENP-O middle region including central RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O middle regi…PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-RnCENP-O-298-GFP
Plasmid#205184PurposeExpresses chimeric rat CENP-O with mouse CENP-O C-terminal RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O C-terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENP-O-R298-GFP
Plasmid#205185PurposeExpresses chimeric mouse CENP-O with rat CENP-O C-terminal RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric mouse CENP-O with rat CENP-O C-terminal …PromoterT7Available SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2 (1-416) (K57A)
Plasmid#197124PurposeExpression of kinase-deficient Myc-tagged PSK2 (aa1-416, K57A) / TAOK1 (aa1-416, K57A) in mammalian cellsDepositorInsertTAOK1 (aa1-416, K57A) (TAOK1 Human)
TagsMycExpressionMammalianMutationChanged K 57 to A and deleted C-terminusPromoterSV40Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…Available SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
K-to-R mutant NPRL3(1-569) in pLJM60, codon-optimized
Plasmid#184563PurposeCMV-driven expression of an untagged mutant NPRL3 (core subunit of GATOR1) — codon-optimized sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.DepositorInsertC16orf35, CGTHBA, FFEVF3, HS-40, MARE, NPR3, RMD11 (NPRL3 Human)
UseLentiviralExpressionMammalianMutationAll lysines were mutated to arginines. Codon-opti…PromoterCMVAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-NF1144AA-shRNAres_W
Plasmid#147898PurposeMammalian Expression of HsNot1iso1-del1097-1110-NF1144AA-shRNAresDepositorInsertHsNot1iso1-del1097-1110-NF1144AA-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot1iso1-del1097-1110-R1138A-shRNAres_W
Plasmid#147899PurposeMammalian Expression of HsNot1iso1-del1097-1110-R1138A-shRNAresDepositorInsertHsNot1iso1-del1097-1110-R1138A-shRNAres (CNOT1 Human)
ExpressionMammalianMutation1 silent mutation and one non silent mutation R23…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.337T>C-Flag
Plasmid#169169PurposeExpresses EPHX1 c.337T>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.337T>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.416A>G-Flag
Plasmid#169170PurposeExpresses EPHX1 c.416A>G in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsflagExpressionMammalianMutationc.337T>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.997A>C-Flag
Plasmid#169171PurposeExpresses EPHX1 c.997A>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.997A>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-Entry-EPHX1c.1212G>C-Flag
Plasmid#169172PurposeExpresses EPHX1 c.1212G>C in mammalian cellsDepositorInsertepoxide hydrolase 1 (EPHX1 Human)
TagsFlagExpressionMammalianMutationc.1212G>CPromoterCMVAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only