We narrowed to 14,247 results for: RON
-
Plasmid#236238PurposeAAV expression of human Junctophilin3 N-terminally tagged with HaloTagDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pRK-ATF4 248-351
Plasmid#26120DepositorAvailable SinceJan. 31, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69898PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-nsp1-c3xFLAG
Plasmid#215694PurposeProduces the Chikungunya virus nonstructural protein 1 with a c-terminal 3xFLAG tagDepositorInsertCHIKV nsp1
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNAintron-CHIKV-nsp2-c3xFLAG
Plasmid#215695PurposeProduces the Chikungunya virus nonstructural protein 2 with a c-terminal 3xFLAG tagDepositorInsertCHIKV nsp2
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNAintron-CHIKV-nsp4-c3xFLAG
Plasmid#215697PurposeProduces the Chikungunya virus nonstructural protein 4 with a c-terminal 3xFLAG tagDepositorInsertCHIKV nsp4
Tags3xFLAGExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNAintron-CHIKV-Envelope protein
Plasmid#215700PurposeProduces the Chikungunya virus envelope protein E3-E2-6K-E1DepositorInsertCHIKV E3-E2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNAintron-CHIKV-capsid protein
Plasmid#215701PurposeProduces the Chikungunya virus capsid proteinDepositorInsertCHIKV capsid
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJET-49-DExogron-mNeonGreen-R11a
Plasmid#179903PurposeDonor with homologous arms for Rab11a to knock in DExogron (=minilAA7-DExCon) mNeonGreen moduleDepositorInsertRAB11A, member RAS oncogene family (RAB11A Human)
UseCRISPR; Donor for homologous based knock inTagsminilAA7-mNeonGreenExpressionBacterial and MammalianPromoterTRE3GSAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
3294_pETcon-SARS2-RBD_Omicron-BA1
Plasmid#184408Purposeyeast surface display of the SARS-CoV-2 Omicron BA.1 variant RBDDepositorInsertSARS-CoV-2 Omicron BA.1 Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationG339D+S371L+S373P+S375F+K417N+N440K+G446S+S477N+T…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Chronos-mT-Sapphire
Plasmid#149690PurposeFor packaging and expression of Chronos-mT-Sapphire in neurons via AAVDepositorInsertChronos
UseAAVTagsmT-SapphireExpressionMammalianPromoterhSynAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1360 - Intron GG3 - smu-1
Plasmid#159806PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG3 - smu-1
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1358 - Intron GG1 - smu-1
Plasmid#159804PurposeGolden Gate compatible intron with PATCs for reduced germline silencingDepositorInsertIntron GG1 - smu-1
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL649 CHYRON2 integration construct
Plasmid#126446PurposeTo integrate the CHYRON2 locus at AAVS1 in human cells.DepositorInsertspU6-CHYRON2 hgRNA
pCMV-puro
ExpressionMammalianMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterCMV and human U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/intron/FlagCter
Plasmid#113548PurposeMammalian expression plasmid that can be used with the Flp-In T-REx system.DepositorInsertFlag
TagsFlagExpressionMammalianAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT234_(pCA-G-intron-tTA2)
Plasmid#36874DepositorInsertsGFP
tTA2
beta-globin intron
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer)Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 myc Caronte (CT#612)
Plasmid#13861DepositorAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Chronos-mT-Sapphire-NRN
Plasmid#149692PurposeFor packaging and expression of Chronos-mT-Sapphire featuring a neuritin (NRN) 3' UTR in neurons via AAVDepositorInsertChronos
UseAAVTagsmT-SapphireExpressionMammalianPromoterhSynAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only