171,035 results
-
Plasmid#235698PurposeExpresses G protein, TVA receptor, and DsRed for rabies virus trans-synaptic tracingDepositorInsertDsRedExpress, TVA800, and Glyco
UseRetroviralPromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MSP1D1deltaH4-H6
Plasmid#71717PurposeMembrane scaffold protein (MSP), helix 4 to 6 deletionDepositorInsertApolipoprotein A1 (APOA1 Human)
ExpressionBacterialAvailable SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP207-AAV-CMV-MCS-pA
Plasmid#78318PurposeAAV vector backbone containing a CMV promoter followed by a multiple cloning site(MCS) followed by a poly-Adenylation Signal (pA)DepositorTypeEmpty backboneUseAAVPromoterCytomegalo Virus(CMV)Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGM190
Plasmid#69614Purposeinducible gene expression in StreptomycesDepositorInsertsaphII
tsr
rep
sso
TipA promoter
dso
UseStreptomyces- e. coli shuttle vectorExpressionBacterialAvailable SinceJan. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE-U2AF2-TurboID-HA-rtTA
Plasmid#226997PurposeIntegrative plasmid to express U2AF2-TurboID in mammalian cellsDepositorAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Blast DEST JNKKTRmRuby2
Plasmid#59154PurposeLentiviral vector to express JNK KTR mRuby2 under PGK promoter (With Blasticidin Resistance)DepositorInsertJNK Kinase Translocation Reporter (MAPK8 Human)
UseLentiviralTagsmRuby2ExpressionMammalianPromoterPGKAvailable SinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgFSP1
Plasmid#186026Purposeknock out FSP1 in mammalian cellsDepositorAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNH605-CCAAT-YFP
Plasmid#172132PurposeFluorescent reporter for HAP complex activityDepositorInsert4xCCAAT-YFP
UseVector for genomic integration into the yeast gen…ExpressionYeastPromoterCYC1 core promotor with 4 tandem repeats of the H…Available SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 2xFLAG-2xSTREP-KEAP1 (human)
Plasmid#236422Purposetransient overexpression of KEAP1 in mammalian cellsDepositorInsertKEAP1 (KEAP1 Human)
ExpressionMammalianAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
SH4-FRB-EBFP2
Plasmid#222418PurposeTo express a plasma membrane "anchor" for rapamycin-induced heterodimerisation in mammalian cellsDepositorInsertSH4
TagsFRB-HA-EBFP2ExpressionMammalianAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230 (LbCpf1)
Plasmid#86210PurposeLbCpf1 Gateway entry plasmidDepositorInsertLbCpf1
UseCRISPR; Gateway compatible lbcpf1 entry cloneTags5' and 3' NLSExpressionPlantAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Luc
Plasmid#36394DepositorInsertFirefly Luciferase
UseRNAi and RetroviralExpressionMammalianAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHR-PGK-scFv GCN4-sfGFP-VP64
Plasmid#122133PurposeExpress a scFv which binds to GCN4, sfGFP and VP64 cassette from the PGK promoterDepositorInsertscFv GCN4-sfGFP-VP64
UseCRISPR and LentiviralExpressionMammalianPromoterPGKAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2207
Plasmid#143354PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIN4-EF2-N2L
Plasmid#21163DepositorArticleAvailable SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-PARP1-E988K
Plasmid#211580PurposeCMV driven PARP1-E988K -eGFP expressing construct with IRES-Neomycin selectionDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT-TO-EGFP-UPF1-WT
Plasmid#136000PurposeDOX-inducible WT UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorInsertUPF1
TagsEGFPExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cdc2-HA
Plasmid#1888DepositorAvailable SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
pmRNA-EGFP-A120
Plasmid#225903PurposeIn vitro transcription of cap-dependently translated mRNA encoding EGFP.DepositorInsertsA-inserted T7 class III Φ6.5 promoter
EGFP
2x β-globin UTR
poly(A) tail
UseSynthetic Biology; Mrna preparationExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only