We narrowed to 3,402 results for: aaas
-
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
p8390 LentiCRISPRv2 Neo sgNT-2
Plasmid#221650PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-2
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-TAK1
Plasmid#117162PurposeTarget site AGCGCCCTTCAATGGAGGAAATDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSV_229
Plasmid#122934PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYBR026C (Marked)
ExpressionYeastMutationYBR026C: bp 52-63 AAGCACTTCAAA to AAACATTTTAAGPromoter[tetO2]4inPgal1Available SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EPN-01(ΔL1+L2)
Plasmid#80051PurposeExpression of EPN-01 mutated in both L domainsDepositorInsertEPN-01(deltaPTAP/deltaYP)
TagsMycExpressionMammalianMutationPTAP10AAAA, YP37AAPromoterCMVAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCJ1021
Plasmid#228761PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Ift88. Use for disruption of mouse Ift88 in cultured cells.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PTEN-shRNA-3001
Plasmid#25639DepositorAvailable SinceJune 21, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-hGtACR2-EYFP
Plasmid#67877PurposeMammalian expression construct of human codon-adapted anion channelrhodopsin 2 from Guillardia theta fused in frame to EYFP via a NotI site in the pFUGW vector backboneDepositorInserthGtACR2
UseLentiviralTagsEYFPExpressionMammalianPromoterUbCAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-sgHPDL #9
Plasmid#174166Purposeknock out HPDL in human cell linesDepositorInsertsgRNA against HPDL
UseLentiviralExpressionMammalianAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-hGtACR1-EYFP
Plasmid#67795PurposeMammalian expression construct of human codon-adapted anion channelrhodopsin 1 from Guillardia theta fused in frame to EYFP via a NotI site in the pFUGW vector backboneDepositorInserthGtACR1
UseLentiviralTagsEYFPExpressionMammalianAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF644_2
Plasmid#86306PurposeEncodes gRNA for 3' target of human ZNF644DepositorInsertgRNA against ZNF644 (ZNF644 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L3L2
Plasmid#113740PurposeGateway entry vector containing attL3 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L4
Plasmid#113736PurposeGateway entry vector containing attL1 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L2
Plasmid#113735PurposeGateway entry vector containing attL1 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN1-exon7-ESE1
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L5L2
Plasmid#113738PurposeGateway entry vector containing attL5 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-R4R3
Plasmid#113739PurposeGateway entry vector containing attR4 and attR3 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only