We narrowed to 3,323 results for: pEGFP
-
Plasmid#112245Purposeexpression of mutant p47phoxDepositorAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pEGFPN1-N-gamma-tubulin (334-449)
Plasmid#87859PurposeFluorescent fragment of gamma-tubulin containing gamma-tubulin DNA binding domain and NLSDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationfragment from aa 334 to 449Available SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-β-catenin_S23A,T40A,T41A,T112A
Plasmid#190824PurposeFor mammalian expression of β-catenin with 4 O-GlcNAc sites mutated (S23A, T40A, T41A and T112A) and GFP-tag on its N-terminus.DepositorInsertβ-catenin (CTNNB1 Chicken)
TagsGFPExpressionMammalianMutationS23A, T40A, T41A, T112APromoterCMVAvailable SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N1 Dynamin1 T292A L293A P294A
Plasmid#112104PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 L330R Q334R L702R
Plasmid#112105PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 D406R M407R T488W
Plasmid#112111PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Kind2 S159/181/666A
Plasmid#105310PurposeTo study altered downstream functions of phospholylation-site null kindlin2DepositorAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-GFP-Ubl4A-H1(90-107)
Plasmid#87202PurposeTo express Ubl4A (90-107 residues) tagged with FLAG-EGFP at N- terminus.DepositorInsertUBL4A (UBL4A Human)
TagsFLAG and GFPExpressionMammalianMutationResidues from 90-107 are inserted.PromoterCMVAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-GFP-Ubl4A-C(90-157)
Plasmid#86923PurposeTo express Ubl4A (90-157 residues) tagged with FLAG-EGFP at N- terminus.DepositorInsertUBL4A (UBL4A Human)
TagsFLAG and GFPExpressionMammalianMutationResidues from 1-89 are deletedPromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypEGFP
Plasmid#153203PurposeCan be used to generate AAV virus that will mark the presynaptic terminal (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertsynaptophysin-EGFP
UseAAVPromoterrat synapsinAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1 MOSPD3
Plasmid#226405PurposeExpression of human MOSPD3 fused to EGFP in mammalian cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-ORAI1-EC-HA
Plasmid#174335Purposeencodes hORAI1 with HA-tag in its extracellular loop 2 and an N-terminal GFP fusion (GFP-ORAI1-EC-HA).DepositorInserthuman Orai1 (ORAI1 Human)
TagsGFP in the N-terminus and HA tag in the extracell…ExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TOP1-GFP-pEGFP-N1
Plasmid#238377PurposeExpresses mCherry-DNA Topoisomerase 1-GFP in mammalsDepositorAvailable SinceMay 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R168X (pc4748)
Plasmid#248577PurposeMammalian expression plasmid of MeCP2-R168X (aa1- aa167)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R255X (pc4749)
Plasmid#248578PurposeMammalian expression plasmid of MeCP2-R255X (aa1- aa254)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
FRB-mUSH1C-DFCR-pEGFP
Plasmid#251431PurposeMammalian expression vector for expressing the actin-binding motif of mouse harmonin b with an N-terminal FRB and a C-terminal EGFPDepositorInsertThe DFCR fragment (residues 296-728 of Ush1C) (Ush1c Mouse)
TagsEGFP and FRBExpressionMammalianAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_POLH_ΔGG NEDD8
Plasmid#221870PurposeExpresses GFP-tagged WT POLH fused to ΔGG NEDD8 in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_D652A POLH
Plasmid#221871PurposeExpresses D652A POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1_N-NLS_K682A_K686A_K694A_K709A POLH
Plasmid#221872PurposeExpresses K682A_K686A_K694A_K709A POLH with an N-terminal NLS-GFP tag in mammalian cellsDepositorInsertPOLH (POLH Human)
TagsNLS-EGFPExpressionMammalianMutationK682A, K686A, K694A, K709APromoterCMVAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only