We narrowed to 3,327 results for: pEGFP
-
Plasmid#62032Purposemammalian expression of nuclear envelope transmembrane proteinDepositorInsertKHLH31
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
NET33 pEGFP-N2 (594)
Plasmid#61987Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-hRIP1-FL I541P
Plasmid#61381PurposeExpresses Human full length RIPK1 with I541P mutation in the mammalian cellsDepositorInsertFull length human RIP1with I541P mutation (RIPK1 Human)
TagsEGFP and HA tagExpressionMammalianMutationchanged I541 to PAvailable sinceJan. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a I18A
Plasmid#40043DepositorInserthSlp4-a I18A (SYTL4 Human)
TagsEGFPExpressionMammalianMutationIsoleucine 18 to AlaninePromoterCMV promoterAvailable sinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a linker
Plasmid#40040DepositorInserthSlp4-a linker (SYTL4 Human)
TagsEGFPExpressionMammalianMutationlinker domain (144-353)PromotercmvAvailable sinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-LgBiT-MYPT1(1-314)(KAKA)-Flag
Plasmid#224894PurposeMammalian expression of LgBiT-MYPT1(1--314)DepositorInsertLgBiT-MYPT1(1-314)KAKA-Flag
ExpressionMammalianAvailable sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-GFP-SF3B6-Delete-NLS-FLAG
Plasmid#86871PurposeTo express SF3B6 delete NLS signal with a GFP and FLAG tags at N- and C-terminus, respectively.DepositorInsertSF3B6 (SF3B6 Human)
TagsEGFP and FLAGExpressionMammalianMutationamino acids 7-29 deletionPromoterCMVAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFPc1 hp47phox (S303/304/328D)
Plasmid#112245Purposeexpression of mutant p47phoxDepositorAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-N-gamma-tubulin (334-449)
Plasmid#87859PurposeFluorescent fragment of gamma-tubulin containing gamma-tubulin DNA binding domain and NLSDepositorInsertgamma-tubulin 1 (TUBG1 Human)
TagsGFPExpressionMammalianMutationfragment from aa 334 to 449Available sinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-β-catenin_S23A,T40A,T41A,T112A
Plasmid#190824PurposeFor mammalian expression of β-catenin with 4 O-GlcNAc sites mutated (S23A, T40A, T41A and T112A) and GFP-tag on its N-terminus.DepositorInsertβ-catenin (CTNNB1 Chicken)
TagsGFPExpressionMammalianMutationS23A, T40A, T41A, T112APromoterCMVAvailable sinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-N1 Dynamin1 T292A L293A P294A
Plasmid#112104PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 L330R Q334R L702R
Plasmid#112105PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Dynamin1 D406R M407R T488W
Plasmid#112111PurposeMammalian expression plasmid of GFP-tagged Dynamin protein.DepositorAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Kind2 S159/181/666A
Plasmid#105310PurposeTo study altered downstream functions of phospholylation-site null kindlin2DepositorAvailable sinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-GFP-Ubl4A-H1(90-107)
Plasmid#87202PurposeTo express Ubl4A (90-107 residues) tagged with FLAG-EGFP at N- terminus.DepositorInsertUBL4A (UBL4A Human)
TagsFLAG and GFPExpressionMammalianMutationResidues from 90-107 are inserted.PromoterCMVAvailable sinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-GFP-Ubl4A-C(90-157)
Plasmid#86923PurposeTo express Ubl4A (90-157 residues) tagged with FLAG-EGFP at N- terminus.DepositorInsertUBL4A (UBL4A Human)
TagsFLAG and GFPExpressionMammalianMutationResidues from 1-89 are deletedPromoterCMVAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFPC1 MOSPD3
Plasmid#226405PurposeExpression of human MOSPD3 fused to EGFP in mammalian cellsDepositorAvailable sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypEGFP
Plasmid#153203PurposeCan be used to generate AAV virus that will mark the presynaptic terminal (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertsynaptophysin-EGFP
UseAAVPromoterrat synapsinAvailable sinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MeCP2-R168X (pc4748)
Plasmid#248577PurposeMammalian expression plasmid of MeCP2-R168X (aa1- aa167)DepositorAvailable sinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only