We narrowed to 2,018 results for: cas9 expression vector
-
Plasmid#111444PurposeUnified Solo vector pV1382 + sgScADE2 + ScADE2 stop codon repair tempateDepositorInsertCaCas9/sgScADE2/stop-codon repair
UseCRISPRExpressionYeastAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT16
Plasmid#223388PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT26
Plasmid#223398PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by AtU3; BASTA for plants select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT29
Plasmid#223401PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by OsU3; BASTA for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT14
Plasmid#223386PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and sgRNA was by AtU3; BASTA for plant selection.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-CGG
Plasmid#108248PurposeLentiviral vector to express sgRNA targeting "GGCGGCGGCGGCGGCGGCGG" locus by SpCas9DepositorInsertsgRNA targeting GGCGGCGGCGGCGGCGGCGG
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Target-AIDmax
Plasmid#139107PurposeMammalian Target-AIDmax expression vector (pSI-626)DepositorInsertBi_partite_NLS-SpCas9(D10A)-SH3_linker-PmCDA1-UGI-SV40NLS
UseCRISPRExpressionMammalianPromoterCMV promoterAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Target-ACEmax
Plasmid#139105PurposeMammalian Target-ACEmax expression vector (pSI-625)DepositorInsertBi_partite_NLS-TadA*-XTEN_linker-TadA-XTEN_linker-SpCas9(D10A)-SH3_linker-PmCDA1-UGI-SV40NLS
UseCRISPRExpressionMammalianPromoterCMV promoterAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ACBEmax
Plasmid#139106PurposeMammalian ACBEmax expression vector (pSI-632)DepositorInsertBi_partite_NLS-TadA*-XTEN_linker-TadA-XTEN_linker-SpCas9(D10A)-SH3_linker-rAPOBEC1-2xUGI-SV40NLS
UseCRISPRExpressionMammalianPromoterCMV promoterAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-NOG(AtUBI10)-MTAP-LUC
Plasmid#234371PurposeT-DNA vector for expression of the the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAs, no gRNA included (NOG)DepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis Ubi10 and MTAP1 (synthetic)Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAd-PR.CC9
Plasmid#192935PurposeAdenoviral expression vector encoding sgRNAs targeting Trp53 and Rb1, Cre and Cas9DepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaDMDR7-U6-SaDMDL2
Plasmid#78603PurposeAAV vector containing gRNAs (for SaCas9) targeting Dmd introns 22 and 23DepositorInsertU6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionPromoterT3 promoterAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GNT5-blast
Plasmid#208380Purposelentiviral vector for expressing human B3GNT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertBeta-1,3-N-Acetylglucosaminyltransferase 5 (B3GNT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnt 922 c->g (PAM site inactivation)PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5-blast
Plasmid#208381Purposelentiviral vector for expressing human B3GALT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnucleotide change in PAM targeting sequence nt 51…PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCF142_U6-sgRNA
Plasmid#225960PurposeU6-sgRNA (recipient). Expresses U6-sgRNA (recipient) for VLP production. This is a recipient vector for cloning of specific SpyCas9 sgRNAs.DepositorInsertU6-sgRNA (recipient)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iSAM
Plasmid#211495PurposeAAVS1 targeting vector containing an all-in-one DOX-inducible system for CRISPRaDepositorInsertsUniSAM insert
TET-ON
Neo Resistance
Insulator
UseCRISPR and Synthetic BiologyTagsT2A-mCherry TagExpressionMammalianPromoterEF1a, NA, Splicing acceptor, and TREGV promoterAvailable SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#2
Plasmid#174153PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GALT5catdead-blast
Plasmid#220869Purposelentiviral vector for expressing human B3GALT5 with D156A and D243A inactivating mutations and C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertbeta-1,3-galactosyltransferase 5 (B3GALT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationencodes D156A and D243A mutations; also, nucleoti…Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
T7-5'UTR-bpNLS-BxbI-3'UTR-polyA (CJT476)
Plasmid#248216PurposebpNLS-BxbI IVT vector for mRNA productionDepositorInsert5'UTR-bpNLS-BxbI-3'UTR-polyA
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationNonePromoterT7Available SinceMay 12, 2026AvailabilityAcademic Institutions and Nonprofits only