We narrowed to 5,937 results for: plasmid dna
-
Plasmid#78261PurposepsiCHECK2 dual luciferase reporter harboring a mutated let-7 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated let-7 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CTCC to GA…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-5'-ENGRAM
Plasmid#179157PurposepiggyBac plasmid for 5' ENGRAM recorderDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterminPAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE4398
Plasmid#74042PurposeExpresses human codon-optimized LbCpf1 and Lb crRNA.DepositorInsertsLb crRNA
LbCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1 (pBM1219)
Plasmid#140253PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9-P2A-EGFPDepositorInsertBE4max(R33A)-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, D10A in Cas9PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9-KKH-Puro
Plasmid#135966PurposeExpresses SauriCas9-KKH and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
miniABEmax (pRZ900)
Plasmid#131311PurposeCMV promoter expression plasmid for bpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (ABEmax with truncation of WT TadA domain).DepositorInsertbpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_ccdB_lox
Plasmid#183763PurposeBxb1-specific donor plasmid for the cloning of multiple inserts by Golden Gate assembly (BpiI)DepositorInsertccdB
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_L58R
Plasmid#101775PurposeExpresses mutant BAF (L58R) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
ESR1-luciferase
Plasmid#113351Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of ESR1 geneDepositorInsertESR1-enhancer (ESR1 Human)
UseLuciferaseAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bxb1_AJMA
Plasmid#183760PurposeBxb1-specific donor plasmid for integrating transcription units for expressing ASAP2f (2 copies), jRCaMP1b and membrane-localised miRFP703DepositorInsertsASAP2f
jRCaMP1b
miRFP703
ASAP2f
TagsLck and NESExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_2
Plasmid#101075PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_1
Plasmid#101074PurposeEncodes gRNA for 3' target of human KMT2BDepositorInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Sauri-U6-sgRNA scaffold
Plasmid#226921PurposeEncoding SauriABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSauriCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKD068
Plasmid#136471PurposeSSB-GFP IDL fusion expression plasmidDepositorInsertSSB-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP inserted between Phe148 and Ser149PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_889
Plasmid#216080PurposeITRs from AAV2, destination vectorDepositorHas ServiceCloning Grade DNAInsertITRs from AAV2
UseAAV; DestinationExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-V82G (pJUL1828)
Plasmid#131313PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with V82G mutation).DepositorInsertbpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-mPLD4
Plasmid#201185PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD4DepositorTagsHis-Myc, Factor Xa cleavableExpressionMammalianMutationcytosolic and transmembrane domain truncated; add…PromoterCMVAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKD072
Plasmid#136472PurposeSSB-C-term-GFP fusion expression plasmidDepositorInsertSSB-C-term-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP attached to C-terminus at Phe 178PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gDNMT1.Cas9-T2A-GFP
Plasmid#170362PurposePlasmid used for Crispr/cas9 based disruption of human DNMT1.DepositorInsertCas9-T2A-GFP
UseLentiviralAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
QSOX1-luciferase
Plasmid#113352Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of QSOX1 geneDepositorInsertQSOX1-enhancer (QSOX1 Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP9A-luciferase
Plasmid#113354Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of ATP9A geneDepositorInsertATP9A-enhancer (ATP9A Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-miR-34 MT
Plasmid#78259PurposepsiCHECK2 dual luciferase reporter harboring a mutated miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated miR-34 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CCGT to GG…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZJQIBEBT003
Plasmid#140053PurposeThe pZJQIBEBT003 plasmid contains the coding sequence of eMutS-L157C-G233C gene which has the ability of error removal in the gene synthesis process.DepositorInserteMutS-L157C-G233C-CBM-EGFP
TagsHis-TagExpressionBacterialMutationL157C, G233CPromoterT7Available SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gLacZ.Cas9-T2A-GFP
Plasmid#170361PurposeNegative control plasmid used for Crispr/cas9 based disruption.DepositorInsertCas9-T2A-GFP
UseLentiviralPromoterU6Available SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_ARID4B
Plasmid#101072PurposeDonor vector for 3' FLAG tag of human ARID4BDepositorAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_RERE
Plasmid#101069PurposeDonor vector for 3' FLAG tag of human REREDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RERE_1
Plasmid#101073PurposeEncodes gRNA for 3' target of human REREDepositorInsertgRNA against RERE (RERE Human)
UseCRISPRAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-TAF1-A
Plasmid#247346PurposeExpresses SpCas9 and a sgRNA targeting the human TAF1-A loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GT-Dox-AIO-TetOn_ETV2_Down-Tandem
Plasmid#241393PurposeBxb1-GT donor plasmid with downstream tandem syntax for all-in-one doxycycline-inducible expression of ETV2DepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-Nme2-U6-sgRNA scaffold
Plasmid#226933PurposeEncoding Nme2ABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nNme2Cas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-TadA8e-SaKKH-U6-sgRNA scaffold
Plasmid#226935PurposeEncoding SaKKHABE8e and sgRNA cassette on a single AAVDepositorInsertTadA8e, nSaKKHCas9
UseAAVPromoterEFSAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA201
Plasmid#216026PurposeFragmid fragment: (Cas protein) firefly luciferaseDepositorHas ServiceCloning Grade DNAInsertFluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA156
Plasmid#216022PurposeFragmid fragment: (Cas protein) Nanobody binds ALFA tagDepositorHas ServiceCloning Grade DNAInsertNbALFA_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA349
Plasmid#216032PurposeFragmid fragment: (Cas protein) Renilla luciferaseDepositorHas ServiceCloning Grade DNAInsertRluc_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_V222A RAD23B
Plasmid#201580PurposeExpresses a variant of human RAD23B containing mutation V222A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation V222AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_F400A RAD23B
Plasmid#201581PurposeExpresses a variant of human RAD23B containing mutation F400A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationContains mutation F400AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX458_ARID4B_1
Plasmid#101078PurposeEncodes gRNA for 3' target of human ARID4BDepositorInsertgRNA against ARID4B (ARID4B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c043
Plasmid#139766PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, DNA-binding domain, WT (TBXT Human)
TagsAvi-tag (Biotin) and His6-TEVExpressionBacterialMutationContains only amino acids E41- D225PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only