-
Plasmid#199559PurposeGATEWAY-compatible entry vectorDepositorInsertBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites (MIR390a Mustard Weed)
UseGateway-compatible entry vectorTagsExpressionMutationPromoterAvailable sinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.2
Plasmid#201404PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/sh-Col1a1/GFP4_Seq1.2
Plasmid#201403PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-A
Plasmid#138672PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK3 mouse (Sik3 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-A
Plasmid#138670PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK2 mouse (Sik2 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-C
Plasmid#138674PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK3 mouse (Sik3 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK1-D
Plasmid#138668PurposeExpresses a mouse SIK1-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK1 mouse (Sik1 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK2-B
Plasmid#138671PurposeExpresses a mouse SIK2-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK2 mouse (Sik2 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK1-E
Plasmid#138669PurposeExpresses a mouse SIK1-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK1 mouse (Sik1 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-D
Plasmid#138675PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorInsertsgSIK3 mouse (Sik3 Mouse)
UseLentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
IP803: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-Dnmt3a3L
Plasmid#121826PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KL401: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-Dnmt3a3L
Plasmid#121840PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/Dnmt3a-3L scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO602: pMVP (L3-L2) HA tag + pA; CMV::TETa-pA
Plasmid#121802PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + CMV-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream CMV-driven TETaDepositorInsertHA epitope tag-polyA + CMV::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JN511: pMVP (L3-L2) pA; EF1a::eGFP-P2A-TETa-pA
Plasmid#121803PurposepMVP L3-L2 entry plasmid, contains polyA + EF1a-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds EF1a-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + EF1a::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
IG806: pMVP (L3-L2) pA; RIP::eGFP-P2A-TETa-pA
Plasmid#121807PurposepMVP L3-L2 entry plasmid, contains polyA + RIP-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds RIP-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + RIP::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO502: pMVP (L3-L2) HA tag + pA; RIP::TETa-pA
Plasmid#121810PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven TETaDepositorInsertHA epitope tag-polyA + RIP::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidTagsExpressionMutationPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only