We narrowed to 143 results for: dual sgRNA
-
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB31
Plasmid#51295PurposeBinary vector derived from pRGE31. Deliver sgRNA and Cas9 into plants by agrobacterium mediated transformation.DepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRice snoRNA U3 and dual 35S promoterAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
AIO-GFP
Plasmid#74119PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and EGFP-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIO-mCherry
Plasmid#74120PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and mCherry-coupled Cas9-D10A nickase to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNuc-cis
Plasmid#202796PurposeRK2-based conjugative plasmid containing the TevSpCas9 dual-endonuclease for targeted bacterial killingDepositorInsertTevSpCas9, sgRNA cassette, oriT, CenArsHis
ExpressionBacterialAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWRS_1001
Plasmid#192205Purposelentiviral expression of SpCas9 and two pol III promoters for dual expression of sgRNAsDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and RNAiAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB
Plasmid#236764PurposeA piggybac-based cloning vector containing dual sgRNAs for spCas9 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorTypeEmpty backboneUsePiggybacExpressionMammalianPromotermouse U6 promoter, human U6 promoter, CAG promoterAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianPromoterCbhAvailable SinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHK001.23
Plasmid#235484Purposedual NOT gate receiver with bs for sgRNA2 and sgRNA3DepositorInsertNOT gate
UseSynthetic BiologyAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
AA151
Plasmid#215938PurposeFragmid fragment: (guide cassette) for dual expression sgRNADepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v4; rev{H1_v1}
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCROPseq-VEX-optimized-scaffold
Plasmid#203321PurposeModified CROPseq vector for efficient CRISPR screens in hematopoiesisDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
Tagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL452
Plasmid#219502PurposeGolden Gate entry vector for library cloning of msd-sgRNA arrays: GAL7p-Csy4-PaqCI-PaqCI-GAL7t // SNR52p-msr-SUP4tDepositorInsertGAL7p-Csy4-PaqCI-PaqCI-GAL7t // SNR52p-msr-SUP4t
ExpressionYeastPromoterGAL7Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only