We narrowed to 5,242 results for: U6
-
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-AK057321-SVA-mcherry
Plasmid#202821PurposeLentiviral vector modified to express two sgRNAs that delete the SVA within the SVA-lncRNA AK057321 gene (exon 3) with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within SVA-lncRNA AK057321 gene
UseLentiviralExpressionMammalianPromoterU6 (two)Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1-plus
Plasmid#126768PurposeExpression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-shRNA
Plasmid#82697PurposeFor targeting shRNA construct into human AAVS1 locus, using genome editing. Expresses shRNA of interest (cloning: EcoRI and AgeI) under U6 promoter, flanked by AAVS1 homology arms.DepositorTypeEmpty backboneUseRNAiPromoterhPGK, U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
crTet in pSLQ8453
Plasmid#183965PurposeU6-crTet-EF1a-Puro-T2A-BFP-WPREDepositorInsertcrTet
UseLentiviralTagsEF1a-Puro-T2A-BFPExpressionMammalianPromoterU6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN089
Plasmid#91614PurposeExpress sgRNA targeting human FURINDepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330-Flag-SpCas9-HF1 (without sgRNA)
Plasmid#92102PurposeExpression plasmid for human codon-optimized high-fidelity SpCas9-HF1, px330-like backbone (without U6-sgRNA coding sequence)DepositorInsert3xFlag-NLS-Streptococcus pyogenes Cas9-HF1-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10715
Plasmid#183960PurposeU6-crOct4-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10871
Plasmid#183962PurposeU6-SKSKSO(crRNA array)-CAG-dCas12a(WT)-miniVPRDepositorInsertsdCas12a(wildtype)
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832APromoterCAG and U6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9-HF1
Plasmid#126762PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-SpCas9-HF1 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than SpCas9HF1.DepositorInsertB-SpCas9-HF1
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; Q926A; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10713
Plasmid#183958PurposeU6-crSox2-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Sox2
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN066
Plasmid#91601PurposeExpress sgRNA targeting human DPP4DepositorAvailable SinceOct. 12, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-CreERT2 sgRipk4 v3
Plasmid#158048Purposelenti-viral construct with tamoxifen inducible Cre recombinase and U6 driven sgRNA against mouse Ripk4. NO Cas9DepositorInsertRipk4 sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKO_HPRT1_exon2_1_Lb
Plasmid#155051PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only