We narrowed to 5,230 results for: codon optimized
-
Plasmid#84830PurposeMinimos transposon with Peft-3:tdTomato:tbb-2 3'UTR and cbr-unc-119 selection. tdTomato was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and synthetic intronsDepositorInsertC. elegans codon optimized tdTomato
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
miCBE
Plasmid#205413PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with APOBEC3A and UGI driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6__RNA*_pCAG_bpNLS_APOBEC3A(W104A)_XTEN_OgeuIscB*(D61A)_NLS_2xUGI_bGHployA_pCMV_mCherry
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1415
Plasmid#84828PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-tdTomato
Plasmid#62516PurposeExpresses tdTomato under the UbC promoter. This promoter expresses transgenes in neurons at higher levels than plasmids with the CMV. Optimal for tracing axons in tissue clearing proceduresDepositorInserttdTomato
UseAAV and Synthetic BiologyExpressionMammalianPromoterhUbCAvailable SinceMarch 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB65 - pL0_tGFP-I (CDS1)
Plasmid#123182PurposeGolden Gate (MoClo; CDS1) compatible turbo GFP gene from P. plumata with an intron for transient and stable expression in plants (moved to a CDS1 position from pICSL50016; Engler et al., 2014)DepositorInsertturboGFP codon-optimised for plants (P. plumata) with intron, U5 small nuclear ribonucleoprotein component (A. thaliana)
UsePart for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM155: pAAV.CMV-Cas13e (GenScript CO)-NT sgRNA
Plasmid#203451PurposePlasmid expressing active and codon optimised Cas13e with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianMutationCodon optimised using GenScript toolPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPINB-HOIL-1 full-length (1–510)
Plasmid#193858PurposeExpression of human His-tagged HOIL-1 (RBCK1) full-length (1–510) codon optimized for E. coliDepositorInsertHOIL-1 (RBCK1 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationCodon optimised for expression in E. coliPromoterT7Available SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q
Plasmid#184249PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertAtaxin-3 full length with 3 UIMs and 77Q in the Poly-Q track (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationCodon optimization for protein expression in BL2…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATX3-77Q-R388G
Plasmid#184251PurposeRecombinant protein expression and purification. Encodes ataxin-3 full length with 3 UIMs and 13Q in the Poly-Q track-R388G fused with His-Tag and TEV cleavage sequence (N-terminal)DepositorInsertataxin-3 full length with 3 UIMs and 77Q in the Poly-Q track and point mutation R388G (ATXN3 Synthetic, Human)
Tags6x His-Tag and TEV cleavage siteExpressionBacterialMutationC-terminal codon optimization for protein expres…PromoterT7 promoterAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
prhaBAD-anti-rabbit-Nb-Hia5
Plasmid#239627PurposeRhamnose inducible expression plasmid for anti-rabbit nanobody fusion to Hia5 DNA adenine methyltransferaseDepositorInsertHia5
Tags6HIS, MBP, TEV, and anti-Rabbit NanobodyExpressionBacterialMutationCodon optimized for bacterial expressionPromoterrhaBADAvailable SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDB179-HotPETase
Plasmid#218701PurposeEncodes codon optimized HotPETase enzyme for bacterial expressionDepositorInsertHotPETase
Tags10xHisExpressionBacterialAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCas9-Blast
Plasmid#52962PurposeExpresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance from EFS promoter. 3rd generation lentiviral backbone.DepositorHas ServiceLentiviral PrepInsertsCas9
Blasticidin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS-NSAvailable SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBad-sfGFP
Plasmid#85482PurposeArabinose inducible E. coli codon optimized superfolder GFP with C-terminal His6 tagDepositorInsertsuperfolder GFP
Tags6x HisExpressionBacterialPromoterArabinoseAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPMVAu8
Plasmid#98297PurposeEnhancing the upper-part mevalonate pathway; overexpressing codon-optimized Enterococcus faecalis mevalonate pathway genes under the control of consitutive promoters.DepositorInsertPRPL4A-EfmvaS-TEFM1-PRPL15A-EfmvaE -TEBS1
ExpressionYeastAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-APOBEC1-YTH
Plasmid#200158PurposeFor bacterial expression of the APOBEC1-YTH fusion protein for protein purificationDepositorInsertAPOBEC1-YTH
Tags6xHis, HA, and Maltose Binding ProteinExpressionBacterialMutationCodon optimized for E coli expressionPromoterLacZAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-APOBEC1-YTHmut
Plasmid#200159PurposeFor bacterial expression of the APOBEC1-YTHmut fusion protein for protein purificationDepositorInsertAPOBEC1-YTHmut
Tags6xHis, HA, and MBPExpressionBacterialMutationCodon optimized for E coli expressionPromoterLacZAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-TPC
Plasmid#61478PurposeBinary expression vector with A.th. codon-optimized Cas9 for conventional cloningDepositorInsertCas9
UseCRISPRExpressionPlantPromoterPcUbi4-2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-NLS-I-PpoI
Plasmid#46963PurposeFor constitutive or doxycycline-inducible expression of the site specific homing nuclease I-PpoI (human codon optimized). Confers resistance to puro. Use T-REx cells for doxy-inducible expression.DepositorInsertNLS-I-PpoI
TagsHAExpressionMammalianPromoterCMV-TETAvailable SinceAug. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pENO1-iRFP-NATr
Plasmid#129731PurposeIntegration plasmid to overexpress iRFP in Candida albicansDepositorInsertiRFP-Candida albicans codon-optimized
ExpressionYeastPromoterENO1 from Candida albicansAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-bleo-atpD-K155Q
Plasmid#248068PurposeLentiviral expression of a catalytically inactive mutant of the beta subunit of ATPGobble. Use together with pLVX-TetOne-bsd-atpA (#248065) and pLVX-TetOne-puro-atpG (#248067) for a LOF control.DepositorInsertatpD
UseLentiviralTagsFLAGMutationLysine 155 to Glutamine, codon-optimized for expr…PromoterTRE3GSAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-bleo-atpD
Plasmid#248066PurposeLentiviral expression of beta subunit of ATPGobble. Includes ampR and bleoR (zeocin). Use together with pLVX-TetOne-bsd-atpA (#248065) and pLVX-TetOne-puro-atpG (#248067) for active ATPGobble.DepositorInsertatpD
UseLentiviralTagsFLAGMutationcodon-optimized for expression in human cellsPromoterTRE3GSAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-bsd-atpA
Plasmid#248065PurposeLentiviral expression of alpha subunit of ATPGobble. Includes ampR and bsdR (blasticidin). Use together with pLVX-TetOne-bsd-atpD (#248066) and pLVX-TetOne-atpG (#248067) for active ATPGobble.DepositorInsertatpA
UseLentiviralTagsFLAGExpressionMammalianMutationcodon-optimized for expression in human cellsPromoterTRE3GSAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only