We narrowed to 14,983 results for: GRN
-
Plasmid#169939PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and RFP657 from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_NEMF
Plasmid#127126DepositorInsertgRNA NEMF (NEMF Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_LTN1
Plasmid#127125DepositorInsertgRNA LTN1 (LTN1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_PELO
Plasmid#127124DepositorInsertgRNA PELO (PELO Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1S_AmpR
Plasmid#119153PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the seed region
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T2_AmpR
Plasmid#119159PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T3_AmpR
Plasmid#119160PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_T1_AmpR
Plasmid#119158PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' endDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, truncated in the 3' end
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M4NS_AmpR
Plasmid#119156PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with four mismatches in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with four mismatches in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M1NS_AmpR
Plasmid#119155PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with one mismatch in the non-seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with one mismatch in the non-seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos9_AmpR
Plasmid#119152PurposeEncodes sgRNA targeting position 9 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 9 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIAL1
Plasmid#106096PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIAL1DepositorInsertgRNA TIAL1
UseCRISPRAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
MSCV P2Gm p53
Plasmid#19751DepositorAvailable SinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRetrosuper USP28 shRNA-3
Plasmid#15664DepositorAvailable SinceNov. 2, 2007AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_ctrA
Plasmid#133339Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets ctrA gene's promoter from Caulobacter crescentusDepositorInsertsgRNA_ctrA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS469-pLK.O1-SpySgRNA/DTS13-Telomere
Plasmid#85715PurposeTelomere-targeting Spy sgRNA under U6 promoterDepositorInserttelomere sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-PCP-3XNeon-nls
Plasmid#75386PurposePCP-3XNeon-nlsDepositorInsertPCP
UseLentiviralTags3XmNeonGreenExpressionMammalianPromoterEFSAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only