We narrowed to 13,947 results for: CRISPR-Cas9
-
Plasmid#69230PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS4 in mammalian cellDepositorInsertTS4 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSD_FKBP-C-SpCas9MT3-574-1368-NLS-3XHA-NLS-TALETS3
Plasmid#107301PurposeExpresses C terminal (574-1368 aa) R1335K mutant SpCas9 fused to FKBP and TALE-VEGFA-TS3 in mammalian cellsDepositorInsertTruncated SpCas9 (aa 574-1368) fused to FKBP and TALE
UseCRISPRTagsFKBP, SV40NLS, 3xHA, c-Myc NLS, and TALE_VEGFA-TS…ExpressionMammalianMutationTruncated SpCas9 (aa 574-1368) with R1335K mutati…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCC_02 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9NG-NLS-2A-Puro-WPRE
Plasmid#139087PurposeExpresses human codon-optimized Cas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationL1111R, D1135V,G1218R, E1219F, A1322R, R1335V, T1…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_01 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-Cas9-NLS-2A-Puro-WPRE
Plasmid#139086PurposeExpresses human codon-optimized SpCas9 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_03 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9-NLS-2A-Puro-WPRE
Plasmid#139088PurposeExpresses human codon-optimized xCas9 3.7 nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationA262T, R324L,S409I, E480K, E543D, M694I, E1219VAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgGabbr1
Plasmid#240044PurposeKnockdown expression of Gabbr1DepositorInsertgamma-aminobutyric acid type B receptor subunit 1 (Gabbr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterCMVAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 with GyrA intein
Plasmid#58693PurposeExpresses truncated N-terminal SpCas9 domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 productionDepositorInsertHumanized N-Terminal S. pyogenes Cas9 with GyrA Nsplit Intein
UseAAV and CRISPRTags3xFlag, GyrA Nsplit Intein, and NLSExpressionMammalianPromoterCBhAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)
Plasmid#129027Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-mCherry and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR)
Plasmid#209775PurposeCRISPRi for STK3DepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-ABE8e-nSpCas9(D10A/A61R)[N-term] (CA19)
Plasmid#197510PurposeCbh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-nSpCas9(D10A/A61R) (to be used with SpRY C-term constructs)DepositorInsertAAV-[ITR]-pCBh-BPNLS-TadA8e-nSpCas9(D10A/A61R)[N-term]-NpuN-BPNLS-[ITR]
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationABE8e mutations in TadA and nSpRY(D10A/A61R)PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA3
Plasmid#164929PurposeExpresses Non-targeting sgRNA3 control in mammalian cellsDepositorInsertNon-targeting sgRNA3 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-PsppA-mCherry
Plasmid#225428PurposePlasmid encodes SgRNA, SpCas9 and homologous arms for homologous recombination of mCherryDepositorInsertmCherry, Cas9, SgRNA
UseCRISPRExpressionBacterialPromoterPsppA upstream of mCherry and Cas9, P3 upstream o…Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-cmv-SpCas9-TadCBEd-V106W-BlastR
Plasmid#193849PurposeExpress TadCBEd-V106W in mammalian cells with BlastR selection, Tol2 integrationDepositorInsertTadCBEd-V106W
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177342PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequenceDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1295-AAV-EFSNC-dCjCas9-HP1a(72-177)
Plasmid#223140PurposeExpression of truncated HP1a with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 72-177PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1305-AAV-EFSNC-dSaCas9-HP1a(72-177)
Plasmid#223150PurposeExpression of truncated HP1a with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 72-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
IP803: pMAGIC (R4-R3) NLS-Sa dCas9-NLS-Dnmt3a3L
Plasmid#121826PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the Dnmt3a-3L DNA methyltransferase for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/Dnmt3a-3L (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 gfaABC1D-NLS-SaCas9-3xHA-NLS bGH
Plasmid#178960PurposeExpresses saCas9 protein specifically in astrocytesDepositorInsertStaphylococcus aureus Cas9 (SaCas9)
UseAAVTags3x HAPromotergfaABC1D (astrocyte specific)Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 1
Plasmid#51760PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 1
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
p246 eSpCas9_2gRNAs_mH11
Plasmid#164854PurposegRNA vector for targeting mouse H11 locusDepositorInsertgRNAs for targeting mouse H11 locus
ExpressionMammalianPromoterU6Available SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTol2_NBT:Cas9green; erbb2_gRNA171
Plasmid#199337PurposepDEL134; transgenic construct to express cell-specific Cas9 in neurons; ubiquitous erbb2 sgRNADepositorInsertsNBT
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2_LSEC:Cas9green; erbb2_gRNA171
Plasmid#199338PurposepDEL135; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous erbb2 sgRNADepositorInsertsLSEC
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2_claudink:Cas9green; erbb2_gRNA171
Plasmid#199339PurposepDEL142; transgenic construct to express cell-specific Cas9 in oligodendrocytes; ubiquitous erbb2 sgRNADepositorInsertsclaudink
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G
Plasmid#167935PurposeInducible CRISPRi expressionDepositorInsertKRAB-dCas9-DHFR
UseLentiviralPromotertetONAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only