-
Plasmid#107365PurposeInput A for pNP1 OR gate sfGFPDepositorInsertOR gate input A
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNP1 OR input B
Plasmid#107366PurposeInput B for pNP1 OR gate sfGFPDepositorInsertOR gate input B
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNP1 AND input A
Plasmid#107362PurposeInput A for pNP1 AND gate sfGFPDepositorInsertAND gate input A
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNP1 AND input B
Plasmid#107363PurposeInput B for pNP1 AND gate sfGFPDepositorInsertAND gate input B
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pClodANL-FGF2NBAA
Plasmid#107873PurposeBacterial expression of FGF2 minimum export mutant-NanoLucDepositorInsertFGF2-minimal export
UseLuciferaseTagsNanoLucExpressionBacterialMutationC77A, C95A, K128Q, R129Q, K134QPromoterpro DAvailable sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2E06
Plasmid#70899PurposeGateway entry cloneDepositorInsertNAAT1 (NAAT1 Fly)
UseGateway entry vectorTagsExpressionMutationPromoterAvailable sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDNR-gRNA
Plasmid#206990PurposeA plasmid for expression of SaCas9-sgRNA targeting donor plasmidsDepositorInsertDonor plasmid-targeting SaCas9-gRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorInsertmiRaSynuclein(human) (SNCA Human)
UseAAV and RNAiTagsExpressionMutationPromoterCAGAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVDM1001
Plasmid#134660PurposeCRISPR delivery and repair template delivery vectorDepositorInsertCRISPR guide RNA array
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCOLA banana sensor sfGFP
Plasmid#107367PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when exposed to extracted and RPA-amplified banana DNADepositorInsertbanana-detecting toehold + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLSE-shREN
Plasmid#105583Purposeretrovirally express control shRNA with GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNP1 sfGFP toehold switch
Plasmid#107355PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 sfGFP trigger is co-expressedDepositorInserttoehold 7 + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A2NT
Plasmid#62257Purposeexpression of A2NT sgRNA from the arabinose-inducible promoterDepositorInsertA2NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJL1 BSMT1
Plasmid#106287PurposeExpresses BSMT1 in Ecoli off a T7 promoterDepositorInsertBSMT1
UseTagsExpressionBacterialMutationPromoterT7Available sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCOLA kiwi sensor sfGFP
Plasmid#107368PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when exposed to extracted and RPA-amplified kiwi DNADepositorInsertkiwi-detecting toehold + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceOct. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pM378
Plasmid#173174PurposeExpresses C9-1 gRNA-12xMBS from hU6 promoterDepositorInsertC9-1 targeting gRNA-12xMBS
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCol-TGM-luc.1309
Plasmid#32720DepositorInsertluciferase
UseMouse Targeting and RNAiTagsExpressionMutationPromoterTRE and TreAvailable sinceMarch 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pNP1 OR sfGFP
Plasmid#107364PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 OR input A and pNP1 OR input B are co-expressedDepositorInsertOR gate + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNL1 Ecarin
Plasmid#106289PurposeExpresses Ecarin in Ecoli off a T7 promoter in the NEB control cloning vectorDepositorInsertEcarin
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNP1 AND gate sfGFP
Plasmid#107361PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 AND input A and pNP1 AND input B are co-expressedDepositorInsertAND gate + sfGFP
UseTagsExpressionBacterialMutationPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4NT
Plasmid#62261Purposeexpression of A4NT sgRNA from the arabinose-inducible promoterDepositorInsertA4NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3T
Plasmid#62260Purposeexpression of A3T sgRNA from the arabinose-inducible promoterDepositorInsertA3T sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A3NT
Plasmid#62259Purposeexpression of A3NT sgRNA from the arabinose-inducible promoterDepositorInsertA3NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210747PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210748PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 4
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 2- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210746PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 2DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 2
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210745PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
RCP83
Plasmid#163466PurposeBackbone plasmid for insertion of the Saccharomyces cerevisiae promoter library and yeGFPDepositorInsertsPromoter fragment (Sharon2012_1922)
His3 minimal promoter
yeGFP
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A5NT
Plasmid#62263Purposeexpression of A5NT sgRNA from the arabinose-inducible promoterDepositorInsertA5NT sgRNA
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRTagsExpressionBacterialMutationPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
p15aC-4D1D-5
Plasmid#107866PurposeBacterial expression of PIS, PI4K and PI4P5KDepositorInsertsPIS
phosphatidylinositol 4-phosphate 5-kinase
phosphatidylinositol 4-kinase β
UseTagsmycExpressionBacterialMutationPromoterproD and proD (in operon)Available sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shREN
Plasmid#105586PurposeDox-inducible mir30 shREN (control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterTREAvailable sinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL1 Aquamarine
Plasmid#106285PurposeExpresses Aquamarine (an eCFP derivative) in Ecoli off a T7 promoterDepositorInsertAquamarine
UseTags6xHis and TEV cleavage (N terminal on insert)ExpressionBacterialMutationT65S and H148GPromoterT7Available sinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCascade
Plasmid#140622PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and CRISPR RNADepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(entry)
UseCRISPR; TransposonTagsExpressionBacterialMutationPromoterAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEP-shREN
Plasmid#105580Purposeretrovirally express control shRNA with puro resistance and GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralTagsExpressionMammalianMutationPromoterMSCV-LTRAvailable sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only