We narrowed to 35,584 results for: CaS;
-
Plasmid#206288PurposeBacterial expression of SpCas9 Δcys E532C and E945C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E945CPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL26_Cas9-His Δcys M1C/E532C
Plasmid#206287PurposeBacterial expression of SpCas9 Δcys M1C and E532C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationM1C, C80S, E532C, C574SPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-BACH1 Cas9-Resistant
Plasmid#199218PurposeLPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Negative-Feedback circuit (mNF-BACH1 Cas9- resistant). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInserthTetR::P2A::EGFP::BACH1 (BACH1 Human)
TagsEGFPExpressionMammalianMutationsilient mutation at nucleic acid 177 C changed to…PromoterCMV D2ir promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-inducible 3xFlag Mouse Caspase-9 ΔB LS
Plasmid#194927PurposeInducible Expression of N-Terminal 3X Flag Mouse Caspase-9 Minus Large Subunit Region Ala 264 to Asp 353DepositorInsertN-Terminal 3X Flag Mouse Caspase-9 Minus Sequence Encoding Ala 264 to Asp 353 (Casp9 Mouse)
Tags3X FlagExpressionMammalianMutationDeletion of Large Subunit Region Ala 264 to Asp 3…PromoterCMVAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.6RT4-Pct5.1-crRNA(hcdR)-RT(ΔhcdR)
Plasmid#191646PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(hcdR-targeting spacer) hcdR-deleting repair template, used for hcdR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.0RTcgr-Pct5.1-crRNA(AarI)-RT(Δcgr12)
Plasmid#191651PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(nontargeting spacer) cgr1/cgr2-deleting repair template, used as negative control for pXD71Cas10.4RT4DepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
1N/2CxNLS-cMyc-NLP-cMyc enAspCas12a
Plasmid#182126PurposepET21a protein expression vector for 1N/2CxNLS-cMyc-NLP-cMyc enAspCas12a in bacteriaDepositorInsert1N/2CxNLS-cMyc-NLP-cMyc AspCas12aen
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
1N/2CxNLS-cMyc-NLP-cMyc AspCas12a
Plasmid#182121PurposepET21a protein expression vector for 1N/2CxNLS-cMyc-NLP-cMyc AspCas12a in bacteriaDepositorInsert1N/2CxNLS-cMyc-NLP-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
1N/2CxNLS-cMyc-NLP-cMyc LbaCas12a
Plasmid#182124PurposepET21a protein expression vector for 1N/2CxNLS-cMyc-NLP-cMyc LbaCas12a in bacteriaDepositorInsert1N/2CxNLS-cMyc-NLP-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-rabbit-Caspase-4
Plasmid#183375PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-human-caspase-1/4a
Plasmid#183393PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of human caspase-1 fused to catalytic domain of human caspase-4 (CASP1 Human, Synthetic)
UseRetroviralTagsMycPromoterMESVAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-742pUC19-tNGFR-P2A-Caspase8
Plasmid#186099PurposeKnockin of truncated NGFR to target geneDepositorInsertCASPASE8
UseCRISPRMutationWT with tNGFR sequenceAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-cat-Caspase-1/4b
Plasmid#183366PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH321-1-Tier1-PhCMV-dCas9-3xNLS
Plasmid#169595PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-horse-Caspase-4
Plasmid#183380PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-wombat-Caspase-4
Plasmid#183379PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-manatee-Caspase-4
Plasmid#183378PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-sheep-Caspase-4
Plasmid#183376PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-lemur-Caspase-4
Plasmid#183374PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-4
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-tiger-Caspase-1/4b
Plasmid#183372PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-panda-Caspase-1/4b
Plasmid#183371PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-dingo-Caspase-1/4b
Plasmid#183369PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-cheetah-Caspase-1/4b
Plasmid#183373PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-dog-Caspase-1/4b
Plasmid#183365PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-human-caspase-1/4b
Plasmid#183394PurposeExpression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCARD domain of human caspase-1 fused to human caspase-4 (CASP1 Human, Synthetic)
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-dog-Caspase-1/4a
Plasmid#183363PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-fox-Caspase-1/4b
Plasmid#183367PurposeStable expression of mammalian inflammatory caspase gene in mammalian cells by retroviral transductionDepositorInsertCaspase-1/4b
UseRetroviralTagsMycPromoterMESVAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-TREX1 g3 Cas9-T2A-mCherry
Plasmid#164252PurposeTranscription of TREX1 guide RNA and Cas9 expression for CRISPR/Cas9 in mammalian cellsDepositorInsertsgTREX1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g1
Plasmid#155185PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA1DepositorInsertCas13d RUNX1 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only