We narrowed to 1,943 results for: rigi
-
Plasmid#63559PurposeExpression of the Mostaza (yellow) spectral variant of eGFP in bacteria and in mammalian cells. Used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Y203)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged threonine at position 203 with respect to…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
hTRAFD1-pCMV14-3xFlag
Plasmid#73587PurposeExpress human TRAFD1 (FLN29) in mammalian cellsDepositorInsertTRAFD1 (TRAFD1 Human)
Tags3xFlagExpressionMammalianMutationThe original vector hTRAFD1-mCMV14-Flag was a gif…Available SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP10-bio
Plasmid#47719PurposeExpresses enzymatically monobiotinylated full-length MSP10 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP10
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEmpty
Plasmid#214051PurposeEmpty bacterial expression vector with CloDF13 (CDF) origin of replication; used as a negative control in the Haliangium ochraceum type III CRISPR-Cas systemDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAR-9.47_VP1,3
Plasmid#74240PurposeOriginal plasmid described in Choudhury et al. 2015 Mol Ther. for production of AAV-AS vectors. Encodes VP1 and VP3 of AAV9.47DepositorInsertsAAV2 Rep
AAV9.47 VP1
AAV9.47 VP3
UseAAVAvailable SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PM-InPAkt
Plasmid#181915PurposeIndicator of Phosphoinositides using Akt; targeted to the plasma membrane.DepositorInsertpm-InPAkt
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationContains the following mutations with respect to …PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-Tlr4(Lps)
Plasmid#27149DepositorInserttoll-like receptor 4(Lps) (Tlr4 Mouse)
Tags3x FLAGExpressionMammalianMutationchanged Proline 712 to Histidine. Native signal p…Available SinceFeb. 10, 2011AvailabilityAcademic Institutions and Nonprofits only -
RAMA-bio
Plasmid#47786PurposeExpresses enzymatically monobiotinylated full-length RAMA ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAMA
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(Stop66)
Plasmid#63218PurposeExpression of a non-sense mutant version of eGFP (dark) in bacteria and in mammalian cells. Could be used as a reporter for gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(Stop66)
UseLentiviralTagsT7 and his6ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSP9-bio
Plasmid#47740PurposeExpresses enzymatically monobiotinylated full-length MSP9 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP9
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
P12-bio
Plasmid#47725PurposeExpresses enzymatically monobiotinylated full-length P12 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual-eGFP(W66)
Plasmid#63217PurposeExpression of the Celeste (cyan) spectral variant of eGFP in bacteria and in mammalian cells. Could be used as a reporter for quantifying gene targeting and recombineering in mammalian cells.DepositorInsertHis-T7-eGFP(W66)
UseLentiviralTagsHis6 and T7ExpressionBacterial and MammalianMutationChanged tyrosine at position 66 with respect to t…PromoterCMV-EF1α hybrid (CEF)Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
CLAG3.2-bio
Plasmid#47797PurposeExpresses enzymatically monobiotinylated full-length CLAG3.2 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised CLAG3.2
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
ASP-bio
Plasmid#47745PurposeExpresses enzymatically monobiotinylated full-length ASP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised ASP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
RAP1-bio
Plasmid#47794PurposeExpresses enzymatically monobiotinylated full-length RAP1 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RAP1
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
H101-bio
Plasmid#47733PurposeExpresses enzymatically monobiotinylated full-length H101 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised H101
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PTRAMP-bio
Plasmid#47793PurposeExpresses enzymatically monobiotinylated full-length PTRAMP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PTRAMP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNF-KB-Split PS Intein-C tTA
Plasmid#242035PurposeC-terminal segment of a blue-light-controlled split PS Intein tTA gene expression system, co-expressing mCherry under an NF-KB-inducible promoterDepositorInsertSplit PS Intein-C tTA
TagsmCherryExpressionMammalianMutationThe CMV promoter in the original vector was repla…PromoterNF-KBAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA ITPA
Plasmid#237998PurposeInducible lentiviral expression of ITPADepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only