We narrowed to 7,847 results for: aav
-
Plasmid#186048PurposeAAV-mediated expression of LifeAct-jGCaMP8m under the CAG promoter, Cre-dependent expressionDepositorInsertLifeAct-jGCaMP8m
UseAAVTagsLifeAct-6xHisExpressionMammalianPromoterCAGAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)PromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypHaloTag
Plasmid#172280PurposeCre-dependent HaloTag labeling of neuronal presynaptic terminals from the synapsin promoter.DepositorInsertsynaptophysin-HaloTag
UseAAV and Cre/LoxTagsHaloTagExpressionMammalianPromoterrat synapsinAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-ConFonvCon-eGFP-W3SL
Plasmid#218752PurposeProvides AND intersectional (Cre+Flp+vCre) expression of eGFPDepositorInserteGFP
UseAAVPromoterhSynAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-ConFoff-eGFP-W3SL
Plasmid#218751PurposeProvides NOT intersectional (Cre NOT Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoterhSynAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV8-cPE-N
Plasmid#183538PurposeDeliver a split compact Prime Editor in vivoDepositorInsertN-terminal fragment of SpCas9 nickase (H840A)
UseAAVExpressionMammalianAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Rev-FlpO
Plasmid#191209PurposeCre dependent FlpO expression under the control of CAG promoterDepositorInsertFlpO
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_CAG_V5-LOV-Turbo-NES
Plasmid#199670Purposeexpresses V5-LOV-Turbo-NES in mammalian cells, AAV vectorDepositorInsertLOV-Turbo
UseAAVTagsNES and V5PromoterCAGAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GW_Dest
Plasmid#86955PurposeGateway destination transfer plasmid for making AAV. Contains a DIO cassette for cre-induction. Without cre, insert is backwards in reference to promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA
Plasmid#185715PurposeAAV expression of GFP and human α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hDlx_DIO_ChR2_mCherry
Plasmid#224459PurposeAn AAV vector expressing ChR2-mCherry that is dependent on both Cre and the hDlx enhancerDepositorInsertChR2-mCherry
UseAAVExpressionMammalianAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-Best1-sCD200
Plasmid#164424PurposeAAV plasmid expressing soluble CD200 in retinal pigment epitheliumDepositorInsertCD200 (Cd200 Mouse)
UseAAVExpressionMammalianMutationdeleted terminal 40 amino acidsPromoterBest1Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS1
Plasmid#170852PurposeAAV backbone for transgene expression in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_2pabPAC
Plasmid#158969Purpose2P-activatable bPAC for AAVDepositorInsert2pabPAC
UseAAVPromoterCMVAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tetoffbidir -Alb-luc
Plasmid#164078PurposeAAV vector with bidirectional promoter controls expression firefly Luciferase with TRE and Tet-off transactivatorDepositorInsertFirefly Luciferase
UseAAVPromoterAlbuminAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1329 - pAAV EF1a HA-hM4D(Gi)
Plasmid#89150PurposeAn AAV packaging plasmid that expresses HA-tagged hM4D(Gi) inhibitory DREADD from the EF1a promoter.DepositorInserthM4D(Gi)
UseAAVTagsHAExpressionMammalianPromoterEF1aAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ArchT-GFP
Plasmid#63141PurposeAAV-mediated expression of ArchT-GFP under the Syn promoter. Using hGHpA signal.DepositorInsertArchT-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC414 - pAAV EF1a hPREP
Plasmid#59967PurposeAn AAV packaging vector that expresses hPREP under control of the EF1a promoter.DepositorAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-palGFP
Plasmid#190232PurposeAAV vector, high-level expression of EGFP with a palmitoylation signal derived from GAP-43 N-terminus (palGFP) in neuronal cellsDepositorInsertEGFP
UseAAVTagspalmitoylation signal sequenceExpressionMammalianAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only