We narrowed to 5,623 results for: pcas
-
Plasmid#131892PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertFLVCR1 (FLVCR1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-FLVCR1_STOP
Plasmid#161058PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertFLVCR1 (FLVCR1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCNICK
Plasmid#84653PurposeGenome editing for Lactobacillus casei Lc2WDepositorInsertsCas9 nickase
sgRNA
homology arms of LC2W_2179
UseCRISPRTagsExpressionMutationD10APromoterAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
CRISPRmTmG2
Plasmid#69992PurposeThe CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice.DepositorInsertgRNA that targets near LoxP sites
UseTagsExpressionMutationPromoterAvailable sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHSP02
Plasmid#117259PurposeGenome editing for Lactobacillus plantarum WCSF1DepositorInsertCas9, promotor P11-guide-RNA, homologous arms of Lp_0537
UseOtherTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherTagsExpressionMutationPromoterAvailable sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pISFba1
Plasmid#226820PurposeExpressing ISEre1 controled by pCas promoter, λ-red recombinase, SacB and ISFba1 guide RNA targeting pMB1 oriDepositorInsertISFba1
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…TagsExpressionYeastMutationPromoterADH1Available sinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC45A3
Plasmid#132167PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC45A3 (SLC45A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 4, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC45A3_STOP
Plasmid#161333PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC45A3 (SLC45A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
UseTagsExpressionMammalianMutationPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG442
Plasmid#165616PurposeVector for expression of SpCas9-Zif268 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t
UseCRISPRTags3x HA, SV40 NLS, Zif268, and c-Myc-like NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1b
Plasmid#218535Purposehuman FLVCR1b cDNADepositorInsertFLVCR1 (FLVCR1 Human)
UseRetroviralTagsExpressionMammalianMutationAlternative isoformPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast FLVCR1/FLVCR1a
Plasmid#218533Purposehuman FLVCR1/FLVCR1a cDNADepositorInsertFLVCR1 (FLVCR1 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro FLVCR1_sg5
Plasmid#218522PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v1 GFP FLVCR1_sg5
Plasmid#218521PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
JPF0419v
Plasmid#124021PurposeEncodes pCAG driving expression of multicistronic Lyn-tagged iRFP713, cytoplasmic mAzamiGreen, mCerulean-tethered p38 KTR, and Histone 2B fused to mScarlet in a PiggyBac destination vectorDepositorInsertPB_pCAG-Lyn-iRFP713_pCAG-NES-mAzamiGreen_pCAG-p38KTR-mCerulean_pCAG-H2B::mScarlet
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGG422_UV5
Plasmid#165607PurposeVector for expression of the SpCas9 KG variant with sgRNA in E. coli: KG(SpCas9, D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 KG(D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationD1332K and R1333G mutations in SpCas9PromoterlacUV5 driving Cas9 KG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG426_UV5
Plasmid#165608PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationD1135V, S1136R, D1332K and R1333G mutations in Sp…PromoterlacUV5 driving Cas9 VRKG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable sinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only