Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 1,023 results for: Cat

Showing: 41 - 80 of 1023 results

  1. Measuring Kinase Activity at the Single-Cell Level with Kinase Translocation Reporters (KTRs)

    Type
    Blog Post
    ...phosphatase-accessible. Kinase Translocation Reporters (KTRs) Kinase Translocation Reporters (KTRs) are genetically...provides an alternative tool with their Kinase Translocation Reporters (KTRs) whose cellular localization...activity is enhanced, leading to cytoplasmic translocation of the reporter. As a result, the KTR is shuttled...nuclear export and import rates can influence KTR translocation. Work from the Covert lab suggests that these... negligible effect on KTRs, however nuclear translocation rates are another variable to consider when ...measurements of kinase activity in single cells using translocation reporters. Nature protocols, 13 1, 155-169. ...

  3. Arabidopsis in Education: How the Arabidopsis Biological Resource Center Brings Plant Science to Life

    Type
    Blog Post
    ... Our education partnerships have grown to include local school districts, professional education associations...contributed by guest blogger Courtney Price, the Education & Outreach Specialist for the Arabidopsis Biological...resources for Arabidopsis and related species. Located at The Ohio State University in Columbus, Ohio,... more than 100,000 samples to researchers and educators in 60 countries each year. Introducing Arabidopsis...outreach program kicked off with the release of 20 education kits designed for use in K-12 and college-level...Translating Research on Arabidopsis Into a Network of Educational Resources). Arabidopsis is used in research to...blogger, Courtney Price!  Courtney Price is the Education & Outreach Specialist for the Arabidopsis Biological...

  4. Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

    Type
    Blog Post
    ...voltage indicator Archon Article contributed by Shreya Vedantam  Listen to the voltage indicator podcast... genetically encoded voltage indicators. To expand the voltage indicator toolbox, Ed Boyden’s lab developed...customized for protein visualization, relocation, degradation, modification, and scaffolding. In their study...xCas9, and requires no additional chemicals or modifications. This versatility opens up the potential for...Archon1, a novel opsin-based fluorescent voltage indicator. Archon1 can embed itself into the cell membrane...response to blue light (445nm). The discovery and applications of protein partners that bind to only the light...

  5. Early Career Researcher Toolbox: Social Media for Scientists

    Type
    Blog Post
    ... writing for the Addgene blog, sharing Chemistry Cat memes was how I used social media as a scientist....needed to start using Twitter. Sharing Chemistry Cat memes use to be how I used social media as a scientist...remotely as an Addgene Science Communication Intern. Developing science communication skills, while also learning... on a panel about “Social Media for Science Communication” at the American Society for Cell Biology (ASCB...Twitter Learn about using Reddit for science communication ...

  6. Technologies Enabled by NanoLuc® Luciferase

    Type
    Blog Post
    ...GpNLuc and OgNLuc are available through Addgene (Cat.# 70185 and 70186, respectively). Antares Chu, J...construct for Antares is available through Addgene (Cat. # 74279). Enhanced Nano-Lanterns  Suzuki, K., et...et al (2). In this post, I’ll cover two great applications of the NLuc technology. The first couples NLuc...fluorescence. The paper reports a wide variety of applications of the Enhanced Nano-Lanterns including monitoring...2017) Genetically encoded bioluminescent voltage indicator for multi-purpose use in wide range of bioimaging...

  8. Cultivating Community Science at BosLab

    Type
    Blog Post
    ...Experimenting in an Open Source Lab: from CRISPR to Cats Stem Cell Models for Disease & Open Science: Interview...state of Massachusetts. Because we’re conveniently located next to a major Biotech hub, building up our lab...pipetting experience. However, after a few months of dedicated time at BosLab, he became our bacterial transformation...projects range from hacking probiotics to filming educational lab videos, while some are looking to develop...microbial diversity in different soil conditions/locations but to engage the local community (including local...Order Plasmids from Addgene! Find Free and Open Educational Resources at Addgene! ...

  9. 3 Challenges in Plant Synthetic Biology

    Type
    Blog Post
    ...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...biotechnologists face is public perception of genetic modification (GM) and synthetic biology. The mistrust and...cannot build what we do not understand, and the complicated and unique metabolic processes of plants are ...

  10. Story of a SynBio Startup: RevBio's Epiphany (or Lack Thereof)

    Type
    Blog Post
    ...found climbing mountains or playing with his two cats. Keira Havens grew up in Hawaii where she was fascinated...plants engineered to detect explosives and rapidly indicate their presence. They are genetically modified ...enjoy and see a future in. And we decided to make education and outreach a cornerstone of our business, because...

  11. Technique: Probe Phage Genomes for Host Binding Proteins

    Type
    Blog Post
    ...spending time with her horse, and wondering what her cat is thinking. Find her on Twitter @JessicaSacher. ... whole genome amplification (by a mechanism known as multiple displacement amplification) even in the ...same location that their host colonies grew. If your cells of interest stick to the same location as a...adding methyl groups, glycosyl groups, and other modifications to their bases in order to protect their DNA...DNA from host cell nucleases (4). To further complicate matters, even when sequenced, phage genomes tend...compressed nitrogen gas; this shears DNA at random locations and allows for a given fragment size to be selected... for physical shearing exist as well, such as sonication and needle shearing. Essentially, any method ...

  12. DNA Quantification

    Type
    Protocol
    ... Protocols DNA Quantification DNA Quantification You may also like... Addgene’s DNA Quantification Protocol. Protocols... to protein (260/280) is generally used as an indicator of the purity of DNA samples. These days, many...

  13. CRISPR Library Amplification

    Type
    Protocol
    ... Protocols CRISPR Library Amplification CRISPR Library Amplification You may also like... Pooled libraries...quantities of library for experimental applications. Repeated amplifications should be avoided as best as possible...Follow this protocol to perform amplification of CRISPR pooled plasmid libraries in Escherichia coli ...refer to our pooled library material pages for amplification protocols that have been developed by the depositor...available. If a pooled library does not yet have an amplification protocol, the following protocol can be used... CRISPR libraries. This protocol allows the amplification of a pooled-plasmid library in Escherichia coli...genes in an organism's genome, for example. Amplification is usually necessary to produce sufficient quantities...

  14. AAV Purification by Iodixanol Gradient Ultracentrifugation

    Type
    Protocol
    .... The arrow indicates the 60–40% interface. The vertical black line indicates the location of the purified... Protocols AAV Purification by Iodixanol Gradient Ultracentrifugation AAV Purification by Iodixanol Gradient...isomolar density gradient medium suitable for virus purification and isolation of cells, organelles, lipoproteins...and use an iodixanol column gradient for AAV purification. Workflow Timeline Day 1: Purify Day 2: Buffer..., et al. "Recombinant adeno-associated virus purification using novel methods improves infectious titer...opens in a new window) . Right panel: cartoon indicating the position of the needle for harvesting of ...

  15. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ... Protocols Plasmid Modification by Annealed Oligo Cloning Plasmid Modification by Annealed Oligo Cloning...' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' Bottom oligo: 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3'...each of the additional sites in tandem ( NdeI - CATATG , PacI - TTAATTAA , AscI - GGCGCGCC , MfeI - CAATTG...compliment so that they can anneal. Top oligo: 5' - CATATG TTAATTAA GGCGCGCC CAATTG - 3' = 28 bp Bottom oligo... final oligos 34 bp each: Top oligo: 5' - AATTC CATATG TTAATTAA GGCGCGCC CAATTG G - 3' Bottom oligo: 3...

  17. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TCTAATTGGTCTGTACCTaaagtggccgctaaggAAGCCCCCTGGGCTGATA lycat TAL3482 & TAL3483 TCCTTCATCTTCATCCAGcggcgctgggaggacgACCGCACACACATGAGCA lyl1 TAL3110...abcg2a TAL3400 & TAL3401 TGTCCTCATCCCCGTCCCgccgcggcgccaccgtCAGCTTCCACAACATCAA adam15 TAL3016 & TAL3017...TAL3017 TGTTTCTGGCGGACTCTCgtcaccattcttctgtTTGAAGGCACACCTTTGA ahcyl1 TAL3018 & TAL3019 TGACAGACTGTGGCGAGGatgccaagctggaggcGACGAAACAGGCCAGCAA...Aminopeptidase-o TAL3020 & TAL3021 TGATCTGGATCCTAACAAggatgacttgcccctgtGTGCGAACACCAACCATA arf6 TAL3212 & TAL3213 TGGGGAAGATGCTTTCCAagatcttcggcaacaaGGAGATGAGAATATTGA... arnt1 TAL3214 & TAL3215 TCCCGTCTCTGGCCATGAcctcctctaatggatcTCATTCCAACGGTGTGCA apoa4 TAL3022 & TAL3025 ...TAL3025 TGGCAGGACCAACCAATGcccagcatggacctggTGAAAAATGCTTTCTGGA apoa4-like TAL3023 & TAL3024 TGAAGGTTCTTGTGGTGCtcacacttgctgtggtTACAGGTAAGAAACTAAA...arap3a TAL3026 & TAL3027 TGGCAACAATCGGTCCGTgctcagatgcagaggaCCTGTTGGCTTCCATCCA ARSA TAL 3002 & TAL 3003...

  18. Validated gRNA Sequences

    Type
    Collection
    ...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut ...Wolfe LYP1 S. cerevisiae CATAATAACGTCCAATAAAT 60847 cut S. pyogenes 25139909 Cate Mettl14 M. musculus GCCGCTCCCGGATCTCCTGC... sapiens GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut...sapiens TGACATCAATTATTATACAT cut S. pyogenes 26789497 Corn CXCR4 H. sapiens CCTCTTTGTCATCACGCTTC cut S.... sativa CATATAGTTGGGTCATGGCA cut S. pyogenes 26479191 Kim DWD1 O. sativa TGCATCGTCCAAGCGCACAG cut S. pyogenes...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...

  19. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...encoded sensor and small molecule indicator: implications for quantification of cytosolic Zn(2+). ACS Chem... few popular categories of biosensors or browse all the biosensors tagged in our catalog . Use the article...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal...

  20. CRISPR Guide

    Type
    Collection
    ... organisms, but modifications to various Cas enzymes have extended CRISPR applications to increasingly...following the amplification protocol specified by the depositing lab. After amplification, you’ll need ...heritability. Not all modifications are stable across cell divisions, and some types of modifications are more frequently... subsequently isolated by affinity purification. After purification, molecules associated with the locus...conventional methods for genomic purification, CRISPR-based purification methods are more straightforward...and SHERLOCKv2) allows for greater amplification and quantification and can be used on lateral flow strips...table above, 3' and 5' indicate on which end of targeted sequence the PAM is located. The majority of the...

  21. Antibody Guide

    Type
    Collection
    ...Handling Visualization Signal Amplification Application Overview Quantification Methods Capture Methods Visualization...Antibody Applications Antibody-based applications can be generally classed into four categories: Quantification... Read on to learn more about the applications common to each category, including an outline of the basic...these applications, visit the Antibody section of the Addgene Protocols page. Antibody Applications - Quantification...concentrates in the sample. Controls for quantification methods Quantification methods should be run with: a positive...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...production and storage techniques, and explain common applications. Science...

  22. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Selectable Marker PI Publication Epigenetics To make targeted epigenetic modifications, researchers have ...DNA. Fusing the catalytic domain of ADAR2(E488Q) adenosine deaminase to catalytically dead Cas13b creates... Gene/Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9) fused to a...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...

  23. Zinc Finger Consortium: Zinc Finger Arrays

    Type
    Collection
    ...OPEN gAGCATCACCtcgctGGAGGTGAGc PTRF/Cavin1 OZ513 and OZ514 OPEN OPEN gACAGCCGTCtgcatctGGAGGTGCCc pitrm1...OPEN OPEN aGCCATCATCaggttcaGGATGAGCCc Kif6 OZ537 and OZ538 OPEN OPEN aAGCTTCCTCttcattgGCTGACTGCa ldr (low...CODA OPEN cAACCTCAGCATAAAGCTGGAGGAg psen2 OZ577 and OZ578 CODA OPEN cGGCATCTCCAGAGCCCGAGGCGGACc zgc:162148...hydroxylase (dbh) OZ525 and OZ526 OPEN OPEN tCCCATCCTAtcgttGCATGAGCTc mdka (midkine-related growth factor) OZ527...lipoprotein receptor) OZ539 and OZ540 OPEN OPEN tTGCATCCACggcagTCGGCAGTGc Encephalopsin (Opn3) OZ541 and OZ542 OPEN... OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt NFATc1 OZ543 and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc Swachmann-Bodian-Diamond...gCGCCACGGAcaataaaGAGGACTGCa GUSB OZ551 and OZ552 OPEN OPEN gGTCATCTGCcattcGAGGCGGACa REST corepressor 2 OZ553 and OZ554 OPEN...

  24. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...therapeutic applications. Despite the ethical controversies surrounding non-research applications, it’s clear...just as useful (if not more so) for research applications, eclipsing past genome engineering technologies...number/types of Cas proteins. Makarova et al. ’s classification defines 5 types and 16 subtypes based on shared...for CRISPR genomic editing. Genome Engineering Applications In 2012, Jinek et al. first demonstrated that... PubMed lists more than 6,300 CRISPR-related publications, many of which detail work to improve the tool...

  25. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional... Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...population. ID Plasmid Promoter PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function Genome Editing...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...gRNA Design Tools CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein...

  26. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...plasmids containing only the elements needed for replication in the host cell and are designed for a user ...Protein Function: Viral Vector Delivery, Genome Modification, mRNA Regulation, and More Selectable Markers...collection page Zebrafish CMV, h2afv, XlEef1a1 See our dedicated Zebrafish Plasmids and Resources collection page...Additionally, tags are commonly added to aid in protein purification. Just remember to remove the stop codon for ...myristoylation signal GST Protein purification pEBG - N-terminal GST for mammalian...expression GST plasmids made by Addgene MBP Protein purification pET28-MBP-TEV - Bacterial expression with MBP-TEV...MBP-tagged fusion proteins in E. coli SUMO Protein purification pCIOX - Bacterial expression vector for His8...

  27. CRISPR Plasmids - Purify Genomic Loci

    Type
    Collection
    ...Catalytically inactive CRISPR plasmids for purification of target loci....conventional methods for genomic purification, CRISPR-based purification methods are more straightforward and...Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...chromatin immunoprecipitation (ChIP) to allow purification of any genomic sequence specified by a particular...DNA-binding molecule-mediated ChIP) system, catalytically inactive dCas9 is used to purify genomic DNA... can be fused to dCas9 or gRNA for efficient purification. Various epitope tags including 3xFLAG-tag, ...

  28. Plan Your Experiment

    Type
    Collection
    ...Manipulation Select Expression System Design gRNA Publications Get Started CRISPR is a powerful system that...may not be a perfect plasmid for your specific application, and in such cases, it may be necessary to customize...reagent to suit your needs. Genetic Manipulation Application Cas9 gRNA Additional Considerations Knockout ...method Expression System Components of System Application Mammalian expression vector Cas enzyme promoter...gRNA complex, which is delivered to cells using cationic lipids Transient expression of CRISPR components...gene you target will depend on your specific application. For example: To activate or repress a target... that the target sequence be very close to the location of the desired edit, ideally less than 10 bp away...

  29. Immunology Research Plasmids and Resources

    Type
    Collection
    ... CAMP cathelicidin antimicrobial peptide CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37 CAT catalase MGC138422...hCD40L CD70 CD70 molecule CD27L, CD27LG, TNFSF7 CECR1 cat eye syndrome chromosome region, candidate 1 ADGF,...CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037,...phosphoinositide-3-kinase, catalytic, delta polypeptide p110D PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide...and adaptive immune signaling and cell-cell communication. Plasmid...

  30. CRISPR Plasmids - Yeast

    Type
    Collection
    ...Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...

  31. CRISPR Plasmids - Double-Strand Break (Cut)

    Type
    Collection
    ...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans...Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish...Marker PI Publication Xenopus ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Parasites...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

  32. CRISPR Plasmids - Plants

    Type
    Collection
    ...Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...

  33. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495....

  34. AAVED

    Type
    Collection
    ...contribute to this publication. Citation information for openly shared communication: Adeno-Associated ...Addgene's 2018 AAV Education and Development (AAVED) workshop series. The... The AAV Education and Development ...Details Date: Friday September 21, 2018, 9 AM - 5 PM Location: Addgene, 75 Sidney St, Cambridge, MA, 02139 Organizing...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...antibodies and recommended dilutions, etc.), novel applications, or any other useful information. Experimental...

  35. Bacterial Expression Systems

    Type
    Collection
    ...Genome Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter...Reporter Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may...Bacteria? E. coli are commonly used to store and replicate plasmids of all types, but beyond that, researchers...sites within this plasmid. Return to Top Protein Purification Sometimes looking at a protein inside cells ...and, epitope tags can be used to simplify the purification process. Using plasmids in this collection, ...those tags from the purified protein. Protein purification can be challenging, but once you get it right... 5% sucrose. Other empty vectors for protein purification from the Structural Genomics Consortium and ...

  36. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...make targeted epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic ...Marker PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...enhancer for your gene of interest. Available modifications include: histone acetylation by p300 histone...or MQ1 cytosine demethylation by Tet1 These modifications persist over time and are potentially heritable...tables below for CRISPR plasmids for epigenetic modification in mammalian or plant systems. Mammalian ID ...

  37. Caltech Systemic Capsids

    Type
    Collection
    ...Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato...Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-...Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10...Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B22...Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden AAV9...

  38. Serotype Testing AAV

    Type
    Collection
    ...the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 37825-AAV1....the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 50465-AAV1....sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample is denoted...denoted with a .T suffix (for example, AAV1.T). The catalog ID for the 100 µL sized sample does not have the...from the CAG promoter. For information about each catalog item, including the titer and quality control, ... synpasin promoter. For information about each catalog item, including the titer and quality control, ...offers you even more options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral...

  39. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...advantage of using AAV for research is that it is replication-limited and typically not known to cause disease...certain exogenous gene products that mediate AAV replication. This requirement has been circumvented with ...expressing Rep2 and PHP.eB Cap controlled by tTA-TRE amplification system Viviana Gradinaru 103006 pUCmini-iCAP-PHP.S...expressing Rep2 and PHP.S Cap controlled by tTA-TRE amplification system Viviana Gradinaru 127847 pUCmini-iCAP-PHP.V1...expressing Rep2 and PHP.V1 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 175004 pUCmini-iCAP-AAV.CAP-B10...expressing Rep2 and B10 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 175005 pUCmini-iCAP-AAV.CAP-B22...expressing Rep2 and B22 Cap controlled by tTA-TRE amplification system Viviana Gradinaru 185136 pUCmini-iCAP-AAV.MaCPNS1...

  40. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid...Promoter PI Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans...Promoter PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9 fused to a transcriptional activator...
Showing: 41 - 80 of 1023 results