We narrowed to 1,017 results for: PLE

...Resources Addgene Kits MoClo-YTK Yeast Gateway Kit Multiplex Yeast Toolkit (MYT) Markerless Yeast Localization...

...These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the...

... VI CRISPR systems target RNA, not DNA, across multiple systems. RNA Editing Cas13 enzymes fused to deaminases...

... region of MDH. For detailed clone information, please see the MDH Protein Clone Information Sheet, available...

...Propionate Induction Lim Lab RNA Feedback Lu Lab Multiplexed/Programmable Gene Networks Mascher Lab Bacillus...

... with which parts can be combined to construct complex networks. This is accomplished through the use ...

...would like to see available in viral prep format. Please note this does not guarantee viral vector packaging...

...DYKDDDDK, Rho, His, Biotin, EE, GCN4 and Strep. Please visit our Tags and Other Markers Antibody Collection...

...infectious viral particles have been split into multiple plasmids for safety: Transfer plasmid — contains...

...displaces the unedited 5’ flap and the resulting heteroduplex is resolved by the cell’s mismatch repair (MMR...

...mEGFP AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA...

...would like to see available in viral prep format. Please note this does not guarantee viral vector packaging...

... ordering from a for-profit entity, please see our Plasmid Distribution to Industry page. ...

...TALEN 2.0 Golden Gate cloning method. Validated in multiple organisms. Dan Voytas Adam Bogdanove Joung Lab...

...for NmCas9 and BsmBI site for cloning in gRNA: pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) PDF, 49...

...subclass from the conventional mAb to facilitate multiplex labeling with subclass-specific secondary antibodies...recombinant monoclonal antibodies for enhanced multiplex immunolabeling of brain. eLife . 8:e43322. PMID...

...antibody in assays with multiple targets, and is described in more detail in the Multiplex Assays section below...fragments (shown in Figure 2) to completely unrelated molecules. Examples include: scFv - Single-chain fragment...differentiation between multiple antibodies. They are often used in assays that have multiple proteins to detect...application Collect and lyse samples to make proteins available. Tissue samples may need additional processing...proteins from a complex mix. Overview of application Process the tissue or cell culture samples to extract ...capture protein:DNA complexes. After capture, the DNA is released from the complex and can be sequenced...culture samples to extract proteins. Homogenize (tissues only) and lyse. Cross-link the samples with formaldehyde...

... C RISPR- as sociated c omplex for a ntiviral de fense; a complex of multiple Cas enzymes including Cas8...edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using dual...detail later. Read more about Cas9 multiplexing . Browse Plasmids: Multiplex gRNA Vectors Engineering the Cas9...also has more condensed multiplexing capabilities , as it can process multiple gRNAs under a single promoter...can be added to SHERLOCKv2 to detect multiple targets. For example, Cas12 can be added to detect the presence...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex to initiate DNA degradation. Cascade...have extended CRISPR applications to increasingly complex functions, including the ability to selectively...

...of each and some examples of relevant variants. This list is not exhaustive — please browse our Optogenetics...amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA, ...Human codon optimization Example: Halo Increased photocurrent amplitude Examples: eNpHR, eNpHR2.0, eNpHR3.0...Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples: eArch3.0, eArchT3.0 Mac...make it possible to combine multiple opsins in the same experiment. For example, you could use different ... variants to enhance the functionality of ChR. Examples of ChRs from other species include: CsChR (from.../t), ChrimsonR Red-shifted peak action spectra Examples: VChR1, C1V1(t/t), Chrimson, ChrimsonR, Chronos...

...sequence at the restriction cut site, multiple modules with complementary overhangs can be digested and ligated...assembly. Combining multiple Level 2 vectors permits the creation of even more complex constructs constrained... MoClo) is a system for efficiently assembling multiple DNA parts into functional plasmids. It is a powerful...vector creating a single transcriptional unit (for example, a promoter, a 5' UTR, a signal peptide, a protein-coding...modules and components to create plasmids with multiple transcriptional units. MultiGreen Kit Plant Expression...overexpression, gene editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible... MoBiFC - Modular Bimolecular Fluorescence Complementation Toolkit Plant Expression Benjamin Field 50 ...

...chemogenetic receptors were based on G-protein coupled receptors (GPCRs) . The largest class of cell surface...like RASSLs, are based on engineered G-protein coupled receptors, but unlike RASSLs, show insensitivity...classified by the signaling protein that the receptors couple to: Gq-DREADDs Gq-DREADDs signal through the Gαq...is not widely used. There is also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling...For a discussion of alternative DREADD ligands, please see the text. PSAMs Unlike DREADDs, which manipulate...allowed them to respond to their cognate PSEM. For example, PSAM Q79G,Q139G is activated by PSEM 22S , while...developed as agonists for PSAM4. A given PSAM is coupled with an ion pore domain (IPD) to form ligand-gated...

...overhang (blunt ends). Two pieces of DNA that have complementary overhangs, or which are both blunt-ended, can...popular restriction enzyme sites, usually within the multiple cloning site (MCS). You can easily move (subclone...experimental goal. Although Gateway cloning is a simple and efficient cloning method, Gateway vectors and...restriction cloning, once your project has been completed via Gateway cloning. Addgene's collection contains...method that relies on the hybridization of the complementary base pairs adenine (A) and thymine (T). TOPO...overhang on the 3' end of PCR products. The complementary T comes from a pre-cut, linear, cloning-ready... cloning is that it allows for the assembly of multiple fragments of DNA in the chosen orientation at ...

...combinations and only 20 natural amino acids, so multiple codons can encode the same amino acid — a phenomenon... vary broadly in their functionality. In their simplest form, plasmids require a bacterial origin of replication...providing a survival advantage to the bacterial host. Multiple Cloning Site (MCS) A short segment of DNA which... DNA fragments. Cloning vectors tend to be very simple, often containing only a bacterial resistance gene... as cloned DNA, and this process of generating multiple identical copies of a recombinant DNA molecule...for Plasmid Selection Each bacterium can contain multiple copies of an individual plasmid, and ideally would...pressure to maintain and replicate your plasmid over multiple generations. It is important to distinguish that...

...recommended to verify that the library is complete — an incomplete library may lead to false positives or...genes that contribute to a phenotype. At their simplest level, pooled libraries are single preparations... unique gene targeting sequence, but there are multiple sequences targeting each gene in the overall library...lineage tracing or parsing the effects of expressing multiple genes at once. A well-designed screen can help...your screen. If you need to amplify the library, please refer to the depositor’s protocol for the best ...number of plasmids present in the library — for example, the Moffat lab uses 200x the number of cells as...method relevant to the phenotype being studied. Examples of published selection mechanisms for lentiviral...

...CRISPR/Cas9 in mammalian cells as an example, but many of these principles also apply to using CRISPR in other...while testing multiple gRNAs is a good idea for most CRISPR experiments, testing multiple pegRNA designs... process of interest. Do you want to: Generate complete and permanent loss of gene expression or function...perfect world, your gRNA sequence would be an exact complement to your target sequence with no homologous sites...selecting a gRNA, but you likely won’t be able to completely avoid them. To increase specificity, consider...the genomic region you intend to target in your samples to ensure there are no discrepancies with the reference...produce the Cas enzyme, and the enzyme then forms a complex with the gRNA for CRISPR activity. Because you ...

... transcription is simpler than eukaryotic transcription, bacteria still have complex systems of gene regulation... including transcription and the transcription complex. Educational...other hand, the process in eukaryotes is much more complex. Eukaryotes require a minimum of seven transcription...transcription. The Lac operon in bacteria is an example of a negatively-controlled operon (Figure 3). A...involved in the production of tryptophan is an example of a positively-controlled operon. Figure 3: Lac...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span... start site (TSS). Eukaryotic promoters are so complex in structure that the DNA tends to fold back on...

...as adenovirus or herpes simplex virus to replicate in the host cell and complete the lytic cycle. AAVs ...transduction efficiency and alter tropism. For example, AAV2/5, targets neurons that are not efficiently...Hybrid capsids are engineered capsids derived from multiple different serotypes, which can further alter transduction...transduction efficiency and viral tropism. One common example is AAV-DJ, which contains a hybrid capsid derived...blog post on AAVrg for more information. Self-complementary AAV (scAAV) One downside of the use of AAVs ...DNA replication machinery to synthesize the complementary strand, transgene expression may be delayed....capacity of rAAV vectors to ~2.4 kb. Figure 4: Examples of AAV serotypes, pseudotypes, hybrid capsids,...

...hence the use of “retro”. Lentiviruses have more complex genomes, containing packaging genes and accessory...along with virus-specific accessory genes (for example, vif , vpr , vpu , and nef for HIV-1). The LTRs...comparison of second- and third-generation systems, please refer to Table 1. Figure 4: Third-generation lentiviral...integration sites have led to the development of multiple genome-wide analysis pipelines to assess viral...Timms et al. (2018), and Wells et al. (2020) for examples). Pseudotyping Tropism dictates which types of...in the envelope and packaging plasmids. Unless multiple recombination events occur between the packaging.... (2021). CReVIS-Seq: A highly accurate and multiplexable method for genome-wide mapping of lentiviral...

...genomes range between 26–45 kb in length and contain multiple heavily-spliced transcripts flanked by two inverted...harvested about 7–10 days later. Vogelstein designed multiple shuttle plasmids for different purposes. The pAdTrack...that the infection rates are equivalent across multiple viruses. The adenoviral backbone plasmid pAdEasy...transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5/26 combine the high transduction...packaging capacity. Large protein-coding genes and complex gene expression cassettes are often too big to ... also been developed as vaccine candidates for multiple infectious diseases and prostate cancer. Cancer...

... — hence the use of “retro”. Retroviruses have simpler genomes, containing only the necessary packaging...transfection step of the viral packaging cell line. For example, Phoenix™ is a popular second-generation gamma-...in the envelope and packaging plasmids. Unless multiple recombination events occur between the packaging...Hughes, S. H., & Varmus, H. E. (Eds.). (1997). Principles of Retroviral Vector Design. In Retroviruses ...

...from most sequencing services, along with a more complete list of common sequencing primers. These lists...molecular biology, plasmids, and recombinant DNA, please consult Addgene's Molecular Biology Reference page...pGL3 vector Forward SFFV-F ATTGATTGACTGCCCACCTC Spleen focus forming virus 5' LTR Forward SP6 ATTTAGGTGACACTATAG...

...between the glass coverslip and a sample in aqueous buffer it is completely reflected. This reflection occurs...water-like buffer the sample is immersed in. Although the excitation light is completely reflected, energy...microscope to use for a new sample I always start by asking two questions: 1) Is the sample dynamic or static? ...? 2) Is the sample thin (< 15 μm) or thick? These questions will place each sample into one of four categories...capture in these types of samples is their fast movements. Depending on the sample, a temporal resolution... fluorophores higher in the sample. TIRF is also very gentle on the sample as the majority of the laser...sheets of excitation light through multiple focal planes of a sample may also be useful for providing fast...

...more complex experiments. A multiplexed experiment, for example, requires staining with multiple primary...control is generally a sample or group that will have a desired response. For example, if you are studying...to experimental samples (?). B, The inclusion of biological replicates such as multiple mice in each group...control is a sample or group that is not subjected to the experimental condition. In the example above, a ...inhibitors on mice, for example, it would be better to treat and test multiple mice with the drug rather... wild-type and knockout samples. In this test, wild-type and knockout samples are treated with the identical...present in the wild-type samples and absent in the knockout.  If knockout samples are unavailable, try substituting...

...numbers of plasmids. plexWell™ technology overview For any NGS experiment, the DNA sample being sequenced ...costly library prep, as each sample requires an individual library. The plexWell™ workflow is a sequential...carrying sample-specific barcodes. Rather than continuing to process 100s to 1000s of samples individually... of plexWell™’s sequential tagging procedure, the quantities of library molecules for each sample remain... problem in multiplex NGS library preparation. The challenge here is that, as more samples are sequenced...case that individual libraries prepared from multiple samples will then also need to be quantified and re-normalized...in order to be combined with other samples in a single multiplexed pool. The cost of these normalization...

...visualize multiple targets at once. An advantage of multiplexing is that you can ask how multiple proteins... sample type. Sample Preparation This step can involve multiple smaller steps that all help to ensure...and colors makes it easy to perform multiplexed IF. By using multiple primary antibodies made in different... maintains sample morphology with minimal impact to the target epitope. There are multiple methods for...methods you use will depend on target and sample type. Example steps include: permeabilization, antigen...target and sample type. Primary Antibody This is the first antibody applied to your sample, which will... and Imaging Similar to Sample Preparation, this step can involve multiple smaller steps, but the aim...

...detect or analyze complex edits, such as those generated by multiplexed delivery of multiple sgRNAs. Since...For a multiplex sample, ICE includes visual representations of all detected edit types in the sample. The...with each sample. Successfully analyzed samples will display the following parameters: Sample - The unique...indel.   For a complete guide to ICE analysis, including detailed explanation and examples, read the paper...the ICE software has two analysis formats: sample by sample analysis, which can compare up to five editing...results and a list of the analyzed samples (see below).   If the sample run had no issues, the analysis ...perform more in-depth analyses on each sample by clicking on the sample name or on its corresponding bar graph...

... easy to measure sample concentration and purity using only a tiny bit of the sample itself — so easy ...NanoDrop. The principles will apply to similar instruments from other companies, like the Implen NP80 or DeNovix...instrument can calculate a sample’s nucleic acid concentration based on the sample’s absorption at 260 nm (...spectra of a mixed sample.  But, other molecules that may be present in the sample also absorb light...levels exceed 70% of the sample content (Loughrey and Matlock, 2016). So, even samples with “good” A260/280...nm, you may have phenol in your sample.  RNA contaminants DNA samples can also be contaminated with RNA.... To confirm RNA in your DNA sample, you will need to use a complementary assay, such as a fluorescence...

...emulsion droplet technology that fractions the PCR reaction sample into approximately 20,000 droplets. Each... our blog post “Droplet Digital PCR for AAV Quantification.”   Multiplex PCR Multiplex PCR, as the name...utilize multiplex qPCR to quantify the concentrations of multiple starting DNA templates in one sample. It...target DNA levels Multiplex PCR Amplify multiple targets from one sample Disease or pathogen identification... molecular diagnostics.  Digital droplet PCR, ddPCR  Digital droplet PCR or ddPCR is a method that provides...analyzed by a droplet reader, which measures the fluorescence amplitude of each droplet. The fraction ...method in which multiple targets can be amplified in a single PCR experiment using multiple primers all in...

...detecting specific populations of cells in a complex tissue or sample (1). When combined with cell sorters, ...information about the cell’s complexity. A cell with a high degree of internal complexity such as extensive membranes... of cells. During FACS, the sample stream oscillates to generate droplets that are charged as they pass...plate. Each droplet contains a single cell that is assessed for the desired parameter. A droplet containing...rule out dead cells and debris. For example, a whole blood sample will contain a mix of cells including...differences in their size and complexity, cells from a whole blood sample will separate into distinct populations...ensure that samples are single cell suspensions. For cells that tend to aggregate, pass the sample through...

...can test three or more groups (two samples and a control, for example) simultaneously, with up to two independent...differences exist between. For example, if an ANOVA analysis on a five-sample data set yields statistical...appropriate to use if all sample comparison is needed, without a high number of samples (~5). Tukey’s test ...positives. Control vs. all samples Oftentimes there exists a control group and multiple experimental groups,...test assumes your data follows. Fig. 1: Examples of comparable groups with and without equal levels... variance among data.     Fig. 2: Examples of data distribution profiles.   Parametric...They are classic parametric tests and one of the simplest statistical tests available. Tailed t-tests If...

...molecule in an unknown sample. To do this, you serially dilute a control sample of known concentration...extrapolate the concentration of an unknown sample. For example, a BCA assay uses a serial dilution of a ...concentration of the unknown sample based on its measured response. An example of this is shown in Figure...their bicinchoninic acid assay (BCA) to normalize samples before running a western blot. Standard curves ...control protein, incubated alongside an unknown sample with the BCA reagent. The absorbance of both is...you to determine the concentration of the unknown sample.  How do I make the standards for a standard curve...standard curve by serially diluting a known control sample, called a standard. The ideal standard curve has...

... the sample to that of a standard curve to extrapolate the concentration of antigen in the sample. A variety...coated with a competing antigen (green).  The sample (purple) is preincubated with a reporter enzyme labeled...-containing sample with their conjugated primary antibody. Users next incubate the sample with the multiwell...control, include a sample that is known to contain the target antigen. Some examples could be an endogenous...used to quantify the level of target antigen in a sample. While Engvall et al. originally developed the ... proteins and small molecules from a variety of sample types (Engvall 1971). Scientists value ELISAs for...capture antibody that binds to the antigen in a sample and then a second detection antibody binds. The...

...protein:DNA complexes with antibodies specific to your protein(s) of interest. Once the complex is captured... Once you have your sample, the first step is to ensure your protein:DNA complexes will remain bound to...you’re working with a tissue sample, you’ll need to homogenize your sample before moving on to the next...the protein:DNA complexes. Once you’ve finished fragmenting the DNA, spin down the samples to remove cell...protein:DNA complexes and finally (5) isolated the DNA from your antibody:protein:DNA complexes. Your DNA...Homogenization for a tissue sample can also need significant optimization for the sample type and size.) It can...process is very similar for both, though tissue samples do require an extra homogenization step. For this...

...If your plasmid can be classified in multiple categories, please check all of the appropriate categories... a collection that is greater than 75 plasmids, please let us know by contacting [email protected]. ...information directly into the file. Email the completed spreadsheet to [email protected] along with ...plasmid can be added on subsequent pages. Type – please choose from one of the following descriptions for...used to knockdown expression of mRNAs with complementarity to the shRNA sequence. Empty backbone A plasmid...through cloning. *Note — If you will be depositing multiple plasmids and would prefer to send us your plasmid...e-mail us at  [email protected] Special cases Please contact us at [email protected] or +1 (617)-ADDGENE...

...structure of the complementary heteroduplex. Base mismatches cause bulges in the duplex that may not fit...helix, purple; sgRNA, dark blue.   The REC lobe binds tightly to the repeat:anti-repeat duplex of the...This cap is where the DNA:RNA heteroduplex transitions back to DNA duplex, and it’s the reason guide sequences... A RuvC loop caps the heteroduplex and marks the transition back to a DNA duplex. sgRNA, dark blue; target...structurally resemble any other known proteins; they are completely unique to the CRISPR system (Nishimasu et al....CTD, yellow; REC lobe, light blue; bridge helix, purple.   Apo Cas9 changes conformation frequently... these regions, even if they are present in the sample. Other techniques, like electron microscopy and...

...across the board. If the samples or sample conditions change, the multiplexed protocol may have to be ... If there are multiple amplicons, or primer dimers forming, the curve will show multiple peaks.    ...optimizing for LightCycler machines.) Multiplexing It is possible to multiplex qPCR when using fluorescent probe-based...individually run sample when developing the protocol and optimized until the multiplexed and individual ... With the right conditions and parameters, some people find it can detect even smaller differences, and... can be the more optimal choices at times. For example, chemistries that rely on hairpin design of probes...the Lightcycler while being relatively easy to multiplex (Thellwell, 2000). See Table 1 for a comparison...

... worked with people outside the department to accomplish a variety of goals. For example, I worked with...experts that complement your (scientific) skill set and is therefore very useful for complex projects. It...met interesting people at conferences and you have successfully reached out to people outside your organization...Meeting people outside your organization just to have a quick chat can be rather tricky (think people based...Addgene I work with people from various organizations in science and beyond. For example, I help organize...collaborations are becoming increasingly important as more complex approaches to scientific questions become popular...mutual benefit.  Our partnership with SnapGene, for example, allows us to display high-quality maps and annotations...

... can be completely denaturated (left) or complexes may dissociate  (right). B) Protein samples protected...protect fragile samples during cryo-EM grid plunge freezing By Rachel Leeson Cryo-EM samples can be damaged...and structure determination LEA proteins protect samples during cryo-EM grid freezing Engineered and evolved...antibodies for marking astrocytes MagIC-Cryo-EM for sample enrichment and structure determination By Mike ...for low-abundance targets or natively isolated complexes. To address these limitations, the Funabiki Lab...enrichment streamlines the purification and minimizes sample loss while also supporting imaging, making it easy...cryo-EM grid.     Figure 1: MagIC-cryo-EM for sample enrichment and structure determination. A) Schematic...

...cells or tissues contain a complex mix of proteins seen as green squares, purple circles and blue triangles... adjusted depending on the sample. It is important to remember that sample lysates will also contain proteases...capture antibody. This will deplete the nonspecific proteins from the sample prior to beginning the IP....proteins are completely removed. Wash steps should be performed even with a pre-cleared sample.  Eluting ...parallel with both a sample known to express the protein of interest, such as a sample transiently transfected...immunoglobulins, to isolate a specific protein out of a complex mix. Using this technique, users can look for the...the antibody or antibody-target protein immune complexes, wash away unbound protein, elute and measure ...

...your samples. There are a few issues that can arise in this step: protein degradation, incomplete lysing...time.   Samples can run into empty neighboring lanes, so load your gel to ensure your samples and reference...wells. Most people will simply load an extra ladder or technical replicate (ie, leftover sample) to fill ...proteins going completely through the membrane or larger proteins not transferring completely onto the membrane...your protein gradient, compare your diluted samples. If multiple dilutions are showing the same signal (Figure...amount of protein/sample loaded Incubate primary antibody at 4 °C overnight Incomplete washing Ensuring...gradients. Protein gradients use dilutions of your sample or protein of interest to understand the dynamic...