Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 121 - 140 of 876 results
  1. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TGCCTGGCACAGGGGCTctccaccatgctggccAACCTGTTCTCAATGA kinesin-family-member-13a TAL3106 & TAL3107 TGTTCTCTGTTTGAGCGAgtctccacacagcagaGCGACAGTAACAGCTTCA...
  2. Optogenetics AAV Preps

    Type
    Collection
    ...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Please let us know what you would like to ...
  3. Retrograde AAV viral preps

    Type
    Collection
    ...of California, Berkeley). Don’t See What You’re Looking For? Please let us know what you would like to ...
  4. Biosensor AAV Preps

    Type
    Collection
    ...Retrograde AAV Inventory Page . Don’t See What You’re Looking For? Please let us know what you would like to ...
  5. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...several protocols available that may be helpful for working with R-mAbs expressed from the plasmids in this...
  6. Optogenetics Guide

    Type
    Guide
    ...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted...CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent amplitude 490 ChR/T159C...activity 589 eNpHR 3.0 NpHR with addition of trafficking signal from Kir2.1 and ER export signal provide...sodomense 566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1 566 ArchT Light-activated ... Arch. 566 eArchT 3.0 ArchT with addition of trafficking signal from Kir2.1 566 Leptosphaeria rhodopsins...
  7. Molecular Biology Reference

    Type
    Guide
    ... Technology Molecular Cloning Plasmid Elements Working with Plasmids Introduction Types of Plasmids Cloning...to break chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists...primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...entry vectors and TOPO cloning vectors. If you are looking for an empty plasmid backbone for your experiment... number of E. coli strains below and recommend checking out these two Addgene blog posts relating to common...and their recommended concentrations. We suggest checking your plasmid's datasheet or the plasmid map to...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin...
  8. CRISPR Guide

    Type
    Guide
    ...Single-Strand Break (Nick) , Double-Strand Break (Cut) Making Precise Modifications Using Homology Directed Repair...a specific sequence adjacent to the RNA target, making this a very flexible editing system. Editors based...sites was sufficient to repress transcription by blocking initiation. dCas9 can also be fused with transcriptional...target genes. In contrast, CRISPR is capable of making highly specific, permanent genetic modifications...Multicolor CRISPR imaging allows for simultaneous tracking of multiple genomic loci in living cells. One ...fluorescent CRISPR system has been used for dynamic tracking of repetitive and non-repetitive genomic loci,...Another limitation of SpCas9 is the low efficiency of making specific genetic edits via HDR. For specific point...
  9. Antibody Guide

    Type
    Guide
    ...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes...
  10. Chemogenetics Guide

    Type
    Guide
    ...exhibited high levels of constitutive activity, making them less than ideal. DREADDs D esigner R eceptors... previously used in human populations in Japan, making it an attractive option for translational studies...engineered to respond specifically to the anti-smoking drug varenicline. This PSAM carries mutations at...antipsychotic drugs: is M1 agonism a pre-requisite for mimicking clozapine’s actions? Psychopharmacology 178:451...
  11. Sequencing Primers

    Type
    Guide
    ...Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the...promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer...reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT...
  12. Cloning

    Type
    Guide
    ... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that your DNA...site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method. So ...
  13. Adenovirus Guide

    Type
    Guide
    ...see our Biosafety guide for more information on working with adenovirus. Overview of Adenoviral Plasmid...
  14. Retrovirus Guide

    Type
    Guide
    ...Please see our Biosafety page for information on working with retrovirus. Packaging using 293T cells This...
  15. Promoters

    Type
    Guide
    ...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...
  16. Lentiviral Guide

    Type
    Guide
    ...plasmids be used in direct transfections as opposed to making virus? Some (but not all) lentiviral transfer plasmids...
  17. Immunocytochemistry

    Type
    Protocol
    ...PBS on a rocking platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform...PBS on a rocking platform. Section 3: Labeling with antibody Block for 20 min at RT on a rocking platform...platform in 500 µL blocking buffer. Remove the blocking buffer and dispose of it in an appropriate waste container...PBS on a rocking platform. (Optional) Counterstain nuclei with 500 µL of 300 nM DAPI working solution ...Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope 0.5–10...buffer: Dilute 20 µL of Triton X-100 in 10 mL PBS. Blocking buffer: Dilute 0.5 g BSA and 30 µL Triton X-100... 150 µL Triton X-100 in 50 mL PBS. 300 nM DAPI working solution: Prepare a 300 µM DAPI stock solution ...
  18. Western Blot

    Type
    Protocol
    ...side up. Block the membrane in blocking buffer for 1 h at RT on a shaking platform. Wash the membrane 3x... at RT on a shaking platform. Wash the membrane 3x for 5 min in 1X TBST at RT on a shaking platform. Prepare...information specific to your antibody, such as ideal blocking buffer and optimal antibody concentrations. Consider...When the run is complete, select Done. Section 5: Blocking Prepare 1X TBST as follows: 25 mL of 20X TBS 2.5...20 472.5 mL of deionized water Mix well Prepare blocking buffer as follows: Dilute 5% w/v non-fat milk ...milk into 100 mL of 1X TBST. *Pro-Tip* The ideal blocking buffer will vary between antibodies. Refer to ... 3x for 5 min in 1X TBST at RT on a shaking platform. Section 6: Antibody incubation Dilute the primary...
Showing: 121 - 140 of 876 results