...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Synthetic Biology plasmids for metabolic enzymes and pathways. Plasmid...collection of synthetic biology plasmids related to metabolic pathways and components. Examples Include: Biofuels... Plasmid Gene/Insert Vector Type Promoter PI Publication Back to Top Do you have suggestions for other...

...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Drosophila... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Description Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

...of the UV and with a clean, sterile razor blade, slice the desired DNA fragment from the gel. Note: To ...

.... You can find Addgene's sequencing results by clicking on the "View Sequences" link on the Plasmid Information...

...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...Source Species Isotype Reactivity Recommended Applications PI Return to Top Do you have suggestions for...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...using any of these gRNA plasmids and review the publication associated with each plasmid for more information...upstream of a 5' NGG 3' PAM sequence. Which CRISPR application is this gRNA sequence compatible with? CRISPR...gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your ...CRISPR nuclease and function. Please see the publication or plasmid information page, or contact the depositing...plasmids. Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions for other plasmids that...

...Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating EBNA1-mediated... Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating polycistronic... S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating EBNA1 episome Human Fluorescent-tagged EBNA1-...Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1-mediated...RNA Human Non-integrating, polycistronic, self-replicating VEE RNA species expressing human Oct4, Klf4, ...generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54....Science. 2008 Nov 7;322(5903):949-53. Yamanaka Replicating EBNA1 episome Mouse Non-integrating EBNA1-mediated...

...possible to find both single-allelic and bi-allelic cells. Single-allelic cells usually make up the majority...extensive homology of the protospacer followed by PAM. Click here for a target selection tool that should be ...plate. A good reference is this paper in Cell . Click here for a 2013 paper discussing conversion tract...a genotyping assay (such as Sanger sequencing). Click here for a useful reference. I have used 200ng to...very robust in this case for EMX1. Since the publication of our paper, we have two new optimized primers...

...according to speed and time (and temperature, if applicable) listed in your protocol. *Pro-Tip* Spin speed...

... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ... enriched expression of GCaMP6s in axons with cytosolic expression of mKate2 Lin Tian 112005-AAV5 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112005-AAV9 pAAV-hSynapsin1... enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3 Lin Tian 112006-AAV9 pAAV-hSynapsin1.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 164450-PHPeB CN1851-rAAV-hI56i-minBglobin-iCre...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene...

...upstream of a 5' NGG 3' PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR...Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish. Validated...Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor OCT4 H. sapiens...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...

...headings. Click on the publication link to view all plasmids available from the article. Click on the PI...Addgene plasmids for use in synthetic biology applications, or from synthetic biology labs. Plasmid...Plasmid Description Gene/Insert Vector Type PI Publication...

...DNA. Add the diluted PEI dropwise while gently flicking the diluted DNA tube. Incubate the mixture 15-...

... 3:1 ratio is not working or when doing more complicated cloning. While 3:1 will get you in the ballpark...

...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Plant Plasmid Gene... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...Link opens in a new window) . Gibson Assembly® is licensed to New England Biolabs by TelesisBio. Gibson DG...

...as methanol or acetone may be better for some applications. Remove the paraformaldehyde and follow your...

...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...RT template. Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a ...specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...

...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant Plasmid...Marker PI Publication Drosophila Plasmid Gene/Insert Promoter Selectable Marker PI Publication Empty Prime...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...

...distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases they cause....our Search page to look for specific genes or applications that are not listed here. Addgene Microbiology...Enterococcus sp. Geobacillus sp. Haemophilus influenzae Helicobacter pylori Listeria monocytogenes Mycobacterium ...Densmore Lab EcoFlex MoClo : Modular cloning for applications like recombinant protein purification and cell-free...fluorescent protein plasmid collection is organized by application and by color. External Resources European Saccharomyces...