...pAAV-CAG-GFP CAG GFP Control Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKIIa... 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element GFP, membrane-targeted GFP Control Dimidschstein 192552...pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI....CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 99130 pAAV-mDlx-NLS-mRuby2 Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10 These viral vector preparations...

...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV5 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV8 pAAV-mDlx-GFP-Fishell-1 GFP expression...under the control of the mDlx enhancer element Gordon Fishell 83900-AAV9 pAAV-mDlx-GFP-Fishell-1 GFP expression... the control of the mDlx enhancer element Gordon Fishell 83900-AAVrg pAAV-mDlx-GFP-Fishell-1 GFP expression... the control of the mDlx enhancer element Gordon Fishell 83900-PHPeB pAAV-mDlx-GFP-Fishell-1 GFP expression...

...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell...AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control Zeng 50465...50465 pAAV-hSyn-EGFP Syn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKII EGFP Control Roth 114472 pAAV-hSyn-mCherry...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP Syn EGFP...pAAV-hSyn-mCherry Syn mCherry Control Deisseroth 114469 pAAV-CaMKIIa-mCherry CamKII mCherry Control Deisseroth 50459...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth... Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 55641...

...pAAV.GfaABC1D.PI.Lck-GFP.SV40 Control Baljit Khakh AV-5-PV2380 100896-AAV5 pAAV.GFA104.PI.eGFP.WPRE.bGH Control Philip...pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng AV-9-PV0101 105530-AAV9 pAAV.CMV.PI.EGFP.WPRE.bGH Control James ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-1-ALL854 51502-AAV1 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng....SV40 Control Loren Looger AV-1-PV3661 98927-AAV1 pENN.AAV.CAG.Flex.GFPsm_myc.WPRE.SV40 Control Loren ...pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-2-ALL854 51502-AAV2 AAV pCAG-FLEX-EGFP-WPRE Control Hongkui Zeng...pAAV.CMV.LacZ.bGH Control James M. Wilson AV-5-PV1917 105541-AAV5 pENN.AAV.CamKII0.4.eGFP.WPRE.rBG Control James ...pENN.AAV.CMVs.TurboRFP.WPRE.RBG Control James M. Wilson AV-5-PV2213 105547-AAV5 pENN.AAV.EF1a.eGFP.WPRE.rBG Control James M. ...

...Packaging Service AAV Controls Viral Vector Packaging Service: Control AAV Browse our control AAV that express...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 8, 9, rg*, PHPeB, CAP-B10...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894...PHP.eB Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Dimidschstein... 9 Wilson 105598 pAAV.GfaABC1D.PI.Lck-GFP.SV40 GfaABC1D Lck-GFP Constitutive 5 Khakh 105622 pAAV.CamKII...

...option rtTA On Kowarz 16623 pBI-GFP Expression of your gene of interest & GFP from a bidirectional tet-responsive...and an inducible promoter at its 3' end, which controls GFP expression tTA Off Verma 26803 pEnt L1L3 EF1a-tTA... in search of inducible promoters capable of controlling eukaryotic gene expression. Several endogenous... regulator of gene expression, a tetracycline-controlled transactivator (tTA) was developed. tTA was created... transactivator rtTA ( r everse t etracycline-controlled t rans a ctivator) was created by fusing rTetR...Either Lung 11662 pPRIME-TET-GFP-FF3 Lentiviral, miRNA expression (PRIME) system for application in knockdown...cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None Either Elledge 35625...

...Production Titer Quality Control Resources Lentivirus Production Titer Quality Control Resources Overview of... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...subunit (RPP30) as a control for normalization purposes are being used. Quality Control Mycoplasma The 293T...Addgene's viral production methods and quality control for lentivirus and AAV. Viral...virus preps are titered and subjected to quality control by Addgene before being distributed to customers...production protocols, titering methods, and quality control are described below. AAV Production AAV distributed...probes targeting the ITR elements and an internal control of known titer (protocol modified from Lock et ...

...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...library expresses EGFP for easy visualization via direct fluorescence. Morris Control Lentivirus Browse...CRISPR Libraries Cas9 Pooled Barcoding Libraries Control Addgene's lentiviruses are made from plasmids that...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone does not contain SpCas9. 76,441...,114 human genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone contains SpCas9. SpCas9 and 76,...

...many different restriction enzymes. pPro24-gfp contains GFP but all others are empty. pdCas9-bacteria ...Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids...Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may also like… ...Manipulating the genome directly can give you more subtle control over protein expression and activity thereby limiting...fluorophore-tagged MS2 (such as that found in pZS*12-MS2-GFP ) to track RNA localization of your gene of interest...protein’s function under a wide range of highly controlled conditions in vitro , or, if you want to determine...

...pSNAPf-Cox8A Control Plasmid SNAP-tag Control for mitochondrial localization 101124 pSNAPf-H2B Control Plasmid...SNAP-tag Control for nuclear localization 101123 pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell...pCLIPf-H2B Control Plasmid CLIP-tag Control for nuclear localization 101130 pCLIPf-Cox8A Control Plasmid ...CLIP-tag Control for mitochondrial localization 101125 pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell...pMCP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization 101131 pACP-GPI Control Plasmid...-tag Control for cell surface localization 101128 pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag...

...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV... CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre...CAG Retroviral Gage 49056 AAV-GFP/Cre Cre-GFP fusion CMV AAV Gage 49111 pEMS1980 iCre with MCS for inserting...

... AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... catalog item, including the titer and quality control, visit the material page (linked for each catalog... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...

...Plasmids GFP GFP-dependent transcription factors Connie Cepko See Plasmids Dronpa Optical control of protein...Optogenetics Background Fluorescent proteins such as GFP have long been used for labeling, but new methods...regulate a variety of other activities. By using GFP as a scaffold, scientists can design de novo systems...modular components or take advantage of existing GFP-lines for cell-specific manipulation. Plasmids Fluorescent...

...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...

... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...

... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz 60323 pGL4.23...fusions in plants. Renilla luciferase under the control of a CMV promoter is present for normalization ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization Ting Ni ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization. Modified...

...factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for other plasmids... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

... the two reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range... the tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting...carrying two CRISPR guides. The first one binds to sfgfp with either 0, 10, 11, 14, or 20 matching nucleotides...for these two reporters simultaneously. By fusing sfGFP and/or mCherry to genes of interest, it is thus ...

...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ...recombinase, and Kras G12D HDR template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase...within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA(backbone...targeting the neuronal-specific gene NeuN. As a control they designed an sgRNA targeting LacZ, which is... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an Internal Control. Mol Cell. 2016... with different binding affinities or negative-control constructs used to characterize the sensor's behavior...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent... GCaMP6f in PV cortical interneurons under the control of the E2 regulatory element Viral manipulation...in forebrain GABA-ergic interneurons under the control of the mDlx enhancer A viral strategy for targeting...

...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins...

...pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...proteins, including calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors... 140555 pAAV-hsyn-GRAB_DA-mut Syn GRAB_DA-mut (control) none Constitutive 9 Li 140556 pAAV-hsyn-GRAB_rDA1m...140558 pAAV-hsyn-GRAB_rDA-mut Syn GRAB_rDA-mut (control) none Constitutive 9 Li 208698 pAAV-hSyn-GRAB-gDA3m...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...pGP-AAV-syn-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218877 pGP-AAV-syn-flex-iGABASnFR2...

...expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...test the function of your gene of interest in a controlled environment under various conditions. When choosing...fusing your protein to another protein, such as GFP, which allows you to visualize the cellular localization... cells, integrate into host genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...

...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...silencing in the germline. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. - ...Hubbard Lab. Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...

...vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (...packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF, 2.4 MB Zhang GeCKO pooled library amplification...packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Pooled libraries are also available for human...Musunuru CRISPRs in human pluripotent stem cells pCas9_GFP ; gRNA empty vector Protocol at StemBook O'Connor-Giles...

...SYFP2 Clover Green Mammalian Expresses Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-N1...mTurquoise2 Brightness standard used as positive control to characterize mTurquoise2 pmTurquoise2-T2A-Venus...T2A-Venus(L68V) Brightness standard used a negative control (no FRET) with pmVenus(L68V)-mTurquoise2 Back to...to Amber via a 32 amino acid linker mGFP-10-sREACh-N3 Monomeric EGFP attached to super-REACh via a 10 amino...

.../Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII...site-specific recombinases, which can be used to control gene expression. See our Cre-lox Plasmids page ...2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson...

...pTR-UF11 chimeric CMV/Chicken Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F...production , these viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and...

...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...shRNA under the control of a tet-responsive H1 promoter Trono 11651 pLVUT-tTR-KRAB 3rd Inducible expression...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd Gateway...expression variants. Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion; can be used for cDNA expression...other versions of pULTRA. Moore 19319 pLJM1-EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895...plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. ...

...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs...find antibody plasmids for: Common antigens such as GFP or mCherry Monoclonals, Nanobodies, Sybodies, or ...peptide, from the popular SunTag system, fused to sfGFP for imaging. Learn more about antibodies and their...

...Always express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You...to bind to an unallocated codon. Therefore many controls must be used to make sure that these conditions...Mammalian TAG Peter Schultz 50831 pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli various unnatural...or DiZHSeC Mammalian TAG P. Chen 92047 pCOTS-pyl-GFP(35TAG) PylRS M. mazei Cyanobacterial TAG Lital Alfonta...analogs Mammalian TAG Huiwang Ai 160041 pRaGE Pyl TAG GFP Y35TAG PylRS M. mazei Bacterial TAG Lital Alfonta...C321.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter ...reporter George Church 98565 C321.ΔClpS.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, ClpS...

...neurons in the substantia nigra, one of the movement control centers in the brain. The cause of this neuron ...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ...Symptoms include changes in behavior and emotion, uncontrolled movements, memory deficits, as well as difficulty...

...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...

...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...-terminal tags, including Myc, HA, Flag, GST and eGFP epitopes. Zebrafish Tol2 Gateway-compatible Kit ...

...Description Mutations Industry PI Due to export control regulations, MERS and SARS-CoV materials are available...mCherry and firefly luciferase. pLentiEGFPdestablized - EFS-EGFPd2PEST-2A-MCS-Hygro - Lentiviral vector...vector expressing destabilized EGFP. Lenti-luciferase-P2A-Neo - Lentiviral reporter vector expressing firefly...

...available and more are currently undergoing quality control analysis in our lab and will be made available ... Plasmid Description Industry PI Due to export control regulations, MERS and SARS-CoV materials are available...libraries . FlipGFP-based activity reporter of SARS-CoV-2 main protease Mpro. (Unpublished) A FlipGFP-based ...

...Negative Control N/A pEMS1312 cre N/A pEMS1301 cre/EGFP/NLS N/A pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS...N/A pEMS1306 EGFP/NLS N/A pEMS1307 EGFP/NLS N/A pEMS1313 intron-lacZ/NLS Positive Control CAG promoter...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...pEMS1113 EGFP/cre/NLS Ple51 DBH pEMS1362 EGFP/NLS Ple52 DCX pEMS1198 EGFP/NLS Ple53 DCX pEMS1199 EGFP/NLS ...pEMS1167 EGFP/NLS Ple63 DRD1 pEMS1168 EGFP/NLS Ple64 FEV pEMS1129 EGFP/cre/NLS Ple64 FEV pEMS1398 EGFP/NLS ...pEMS1160 EGFP/NLS Ple93 GPR88 pEMS1161 EGFP/NLS Ple94 GPR88 pEMS1162 EGFP/NLS Ple95 GPR88 pEMS1163 EGFP/NLS...pEMS1216 EGFP/NLS Ple99 GRP pEMS1371 EGFP/NLS Ple100 GRP pEMS1372 EGFP/NLS Ple101 GRP pEMS1373 EGFP/NLS Ple102...

...vectors to express your gene of interest under the control of a variety of promoters. Professor Oka and the...promoter pCDH-EF1-copGFP 73030 Expresses copGFP from the EF1 promoter pCDH-EF1s-Nluc-P2A-copGFP-T2A-Puro 73032...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...Lentiviral Vector ID Purpose pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed... N-acethyl-transferase) pCDH-CB-copGFP-T2A-iCre 72256 Expresses copGFP and iCre under from the CB promoter...CB promoter pCDH-CB-FLPe-P2A-copGFP-T2A-Puro 72258 Expresses FLPe, copGFP and the puromycin resistance...tdTomato from the CB promoter pCDH-EF1-Fon-copGFP 72260 Expresses copGFP from the EF1 promoter when FLP is expressed...

...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...have also been used in in vivo RNA imaging or to control alternative splicing. Figure 13: Overview of RNA...Engineered anti-CRISPR proteins for optogenetic control of CRISPR–Cas9. Nature Methods , 15 (11), 924–927...