Protocols
>
pLKO.1 Protocol
Addgene Plasmid 10878. Protocol Version 1.0. December 2006.
Copyright Addgene 2006, All Rights Reserved. This protocol is
provided for your convenience. See warranty
information in appendix.
Click here for a printable copy.
Table of Contents
A.1 The RNAi Consortium The pLKO.1 cloning vector is the backbone upon which The RNAi Consortium (TRC) has built a library of shRNAs directed against 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector available to the scientific community. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed) in all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection.
A.3 Related Products The following plasmids available from Addgene are recommended for use in conjunction with the pLKO.1 TRC-cloning vector.
Note: pLKO.1 can also be used with packaging plasmid pCMV-dR8.2 dvpr (Addgene #8455) and envelope plasmid pCMV-VSVG (Addgene #8454) from Robert Weinberg's lab. For more information, visit Addgene's Mammalian RNAi Tools page. Several other laboratories have deposited pLKO derived vectors that may also be useful for your experiment. To see these vectors, visit Addgene's website and search for "pLKO".
B.1 Determining the Optimal 21-mer Targets in your Gene Selection of suitable 21-mer targets in your gene is the first step toward efficient gene silencing. Methods for target selection are continuously being improved. Below are suggestions for target selection. 1. Use an siRNA selection tool to determine a set of top-scoring targets for your gene. For example, the Whitehead Institute for Biomedical Research hosts an siRNA Selection Program that can be accessed after a free registration (http://jura.wi.mit.edu/bioc/siRNAext/). If you have MacOS X, another excellent program is iRNAi, which is provided free by the company Mekentosj (http://www.mekentosj.com/irnai/). A summary of guidelines for designing siRNAs with effective gene silencing is included here:
2. To minimize degradation of off-target mRNAs, use NCBI's BLAST program. Select sequences that have at least 3 nucleotide mismatches to all unrelated genes.
B.2 Ordering Oligos Compatible with pLKO.1 To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into the oligos below. Do not change the ends; these bases are important for cloning the oligos into the pLKO.1 TRC-cloning vector. Forward oligo: 5' CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3' Reverse oligo: 5' AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3' For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be: Forward oligo: 5' CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG 3' Reverse oligo: 5' AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT 3'
The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI. The oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest. C.1 Recommended Materials
C.2 Annealing Oligos 1. Resuspend oligos in ddH2O to a concentration of 20 μM, then mix:
2. Incubate for 4 minutes at 95oC in a PCR machine or in a beaker of boiling water. 3. If using a PCR machine, incubate the sample at 70oC for 10 minutes then slowly cool to room temperature over the period of several hours. If using a beaker of water, remove the beaker from the flame, and allow the water to cool to room temperature. This will take a few hours, but it is important for the cooling to occur slowly for the oligos to anneal. C.3 Digesting pLKO.1 TRC Cloning Vector 1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:
> Incubate at 37oC for 2 hours. 2. Purify with Qiaquick gel extraction kit. Elute in 30 μL of ddH2O. 3. Digest eluate with EcoRI. Mix:
> Incubate at 37oC for 2 hours. 4. Run digested DNA on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and place in a sterile microcentrifuge tube. 5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 μL of ddH2O. 6. Measure the DNA concentration. C.4 Ligating and Transforming into Bacteria 1. Use your ligation method of choice. For a standard T4 ligation, mix:
> Incubate at 16oC for 4-20 hours. 2. Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells, following manufacturer's protocol. Plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog).
You may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, once you have identified the positive clones, it is important to verify the insert by conducting a sequencing reaction. D.1 Recommended Materials
D.2 Screening for Inserts Day 1:
Day 2:
3. Conduct a restriction digest with EcoRI and NcoI:
> Incubate at 37oC for 1-2 hours. 4. Run the digestion products on a 1% agarose gel. You should see two fragments, a 2kb fragment and a 5kb fragment. 5. Sequence positive clones with pLKO.1 sequencing primer (5' CAA GGC TGT TAG AGA GAT AAT TGG A 3').
For transient knockdown of protein expression, you may transfect plasmid DNA directly into the target cells. The shRNA will be expressed, but the DNA is unlikely to be integrated into the host genome. For stable loss-of-function experiments, Addgene recommends that you generate lentiviral particles and infect the target cells. Addition of puromycin will allow you to select for cells that stably express your shRNA of interest. E.1 Recommended Materials
Note: pLKO.1 could also be packaged using pCMV-dR8.2 dvpr and pCMV-VSVG from the Robert Weinberg lab. For more information, visit Addgene's Mammalian RNAi Tools page. E.2 Protocol for Producing Lentiviral Particles This protocol is for transfection in a 6 cm plate. The protocol can be scaled to produce different amounts of virus as needed. Day 1:
Day 2:
c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail for each transfection:
d. Create a master mix of FuGENE® 6 transfection reagent in serum-free OPTI-MEM. Calculate the amount of Fugene® and OPTI-MEM necessary given that each reaction will require 6 μL FuGENE® + 74 μL OPTI-MEM. For example:
e. Add 80 μL of FuGENE® master mix to each tube from step c for a total volume of 100 μL. Pipette master mix directly into the liquid and not onto the walls of the tube. Mix by swirling or gently flicking the tube. f. Incubate for 20-30 minutes at room temperature. g. Retrieve HEK-293T cells from incubator. The cells should be 50-80% confluent and in DMEM that does not contain antibiotics. h. Without touching the sides of the dish, gently add DNA:FuGENE® mix dropwise to cells. Swirl to disperse mixture evenly. Do not pipette or swirl too vigorously, as you do not want to dislodge the cells from the plate. i. Incubate cells at 37oC, 5% CO2 for 12-15 hours.
Day 3:
k. Incubate cells at 37oC, 5% CO2 for 24 hours.
Day 4:
m. Add 5 mL of fresh media containing antibiotics to the cells and incubate at 37oC, 5% CO2 for 24 hours.
Day 5:
o. Virus may be stored at 4oC for a few days, but should be frozen at -20oC or -80oC for long-term storage.
Lentiviral particles can efficiently infect a broad range of cell types, including both dividing and non-dividing cells. Addition of puromycin will allow you to select for cells that are stably expressing your shRNA of interest. F.1. Recommended Materials
* Detailed protocols for preparing polybrene, protamine sulfate, and puromycin are located in the Appendix. F.2. Determining the Optimal Puromycin Concentration Each cell line responds differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration for your cell line before initiating your experiment. Day 1:
Day 2:
c. Dilute puromycin in the preferred culture media for your target cells. The final concentration of puromycin should be from 1-10 μg/mL in 1 μg/mL increments. d. Label plates from 1-10 and add appropriate puromycin-containing media to cells.
Days 3+:
f. The minimum concentration of puromycin that results in complete cell death after 3-5 days is the concentration that should be used for selection in your experiments. (You may wish to repeat this titration with finer increments of puromycin to determine a more precise optimal puromycin concentration.)
F.3. Protocol for Lentiviral Infection and Selection Day 1:
Day 2:
c. Add lentiviral particle solution from step E. For a 6 cm target plate, add between 0.05-1 mL virus (add ≥0.5 mL for a high MOI, and ≤0.1 mL for a low MOI). Scale the amount of virus added depending on the size of your target plate.
d. Incubate cells at 37oC, 5% CO2 overnight. Day 3:
f. To select for infected cells, add puromycin to the media at the concentration determined in step E.2.
Days 4+:
h. Assay infected cells. The following recommendations are guidelines for the number of days you should wait until harvesting your cells. However, you should optimize the time based on your cell line and assay:
BL2 safety practices should be followed when preparing and handling lentiviral particles. Personal protective clothing should be worn at all times. Use plastic pipettes in place of glass pipettes or needles. Liquid waste should be decontaminated with at least 10% bleach. Laboratory materials that come in contact with viral particles should be treated as biohazardous waste and autoclaved. Please follow all safety guidelines from your institution and from the CDC and NIH for work in a BL2 facility. If you have any questions about what safety practice to follow, please contact your institution's safety office. To obtain the MSDS for this product, visit www.addgene.org/sitemap and follow the MSDS link.
H.1. Published Articles Khvorova A et. al. 2003. Functional siRNAs and miRNAs exhibit strand bias. Cell 115:209-216. (PubMed) Moffat J et. al. 2006. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124:1283-1298. (PubMed) Naldini L et. al. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267. (PubMed) Schwarz DS et. al. 2003. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115:199-208. (PubMed) Stewart SA et. al. 2003. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA 9(4):493-501. (PubMed) Zufferey R et. al. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15(9):871-5. (PubMed) Zufferey R et. al. 1998. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72(12):9873-80. (PubMed) H.2. Web resources Addgene's mammalian RNAi website: www.addgene.org/rnaitools The RNAi Consortium (TRC): www.broad.mit.edu/genome_bio/trc/rnai.html Background on RNAi mechanism: www.nature.com/focus/rnai/animations/animation/animation.htm Whitehead siRNA Selection Program: jura.wi.mit.edu/bioc/siRNAext/ Mekentosj iRNAi Program: www.mekentosj.com/irnai/
I.1. Sequence of pLKO.1 TRC-Cloning Vector Click here (http://www.addgene.org/10878) to see the sequence of pLKO.1 TRC-cloning vector. The vector is 8901 base pairs total, and the stuffer insert is shown in all capital letters. I.2. Recipes Luria Broth Agar (LB agar) + antibiotic Per 40 grams of powder from American Bioanalytical catalog # AB01200-02000, LB contains:
> Prepare LB agar solution by dissolving 40g of LB powder in 1L of distilled water. Autoclave and cool to 55oC. Add 1mL of 100mg/mL ampicillin or carbenicillin to obtain a final concentration of 100 μg/mL antibiotic. Pour plates and store at 4oC. Hexadimethrine Bromide (Polybrene) Prepare a 1mg/mL solution of polybrene (Sigma-Aldrich catalog #H9268) in 0.9% NaCl. Autoclave to sterilize. Stock solution is stable at 4oC for up to one year. The powder form of polybrene is stable at 4oC for several years. Protamine Sulfate Store protamine sulfate (MP Biomedicals catalog #194729) at 4oC. Freely soluble in hot water and slightly soluble in cold water. Puromycin Prepare a 50mg/mL stock solution of puromycin (Sigma-Aldrich catalog #P8833) in distilled water. Sterilize by passing through a 0.22 μm filter. Store aliquots at -20oC. I.3. Warranty Information Addgene is committed to providing scientists with high-quality goods and services. Addgene makes every effort to ensure the accuracy of its literature, but realizes that typographical or other errors may occur. Addgene makes no warranty of any kind regarding the contents of any literature. Literature are provided to you as a guide and on an "AS IS" "AS AVAILABLE" basis without warranty of any kind either expressed or implied, including but not limited to the implied warranties of fitness for a particular purpose, non-infringement, typicality, safety and accuracy. The distribution of any literature by Addgene is not meant to carry with it, and does not grant any license or rights of access or use to the materials described in the literature. The distribution of materials by Addgene is not meant to carry with it, and does not grant any license, express or implied, under any patent. All transfers of materials from Addgene to any party are governed by Addgene's Terms of Use, Addgene's Terms of Purchase, and applicable Material Transfer Agreements between the party that deposited the material at Addgene and the party receiving the material.
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||