169,450 results
-
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUdeltaGW-rtTA
Plasmid#19780Purpose3rd generation lentiviral vectorDepositorInsertreverse tetracycline transactivator
UseLentiviralExpressionMammalianAvailable SinceFeb. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCI SMN1
Plasmid#72286PurposeSMN1 exon 7 splicing cassetteDepositorAvailable SinceJan. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flpo (AAV1)
Viral Prep#55637-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-Flpo (#55637). In addition to the viral particles, you will also receive purified pAAV-EF1a-Flpo plasmid DNA. EF1a-driven Flpo recombinase expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV Retrograde)
Viral Prep#59462-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. tdTomato expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET SUMO-FL-syt1
Plasmid#213628PurposeBacterial expression of SUMO-tagged rat FL-syt1DepositorAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
COM-epegRNA-Dnmt1
Plasmid#211376PurposeDnmt1 targeting epegRNA with COM insertion in gRNA scaffold for v3b PE-eVLP productionDepositorInsertCOM-epegRNA
ExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBBR1MCS-2
Plasmid#85168PurposeMobilisable shuttle and expression vector. Replicates in many Gram-negative bacteria. Has multiple cloning site with blue/white selection function. Cloned genes driven by derepressed lac promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneExpressionBacterialPromoterConstitutive (derepressed P-lac)Available SinceNov. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGAL4-DBD-MCS
Plasmid#145245PurposeBackbone vector expressing GAL4 DNA-binding domain followed by MCSDepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3 Basic Vector
Plasmid#212936PurposeFirefly luciferase vector for investigating regions controlling transcriptionDepositorTypeEmpty backboneUseLuciferaseMutationWTAvailable SinceJan. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-DIO-mCherry (AAV2)
Viral Prep#50459-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-DIO-mCherry (#50459). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-mCherry plasmid DNA. hSyn-driven, Cre-dependent mCherry-expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-mCherry-IRES-Cre (AAV Retrograde)
Viral Prep#55632-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-mCherry-IRES-Cre (#55632). In addition to the viral particles, you will also receive purified pAAV-Ef1a-mCherry-IRES-Cre plasmid DNA. Cre and bicistronic (IRES) mCherry expression under the EF1a promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1a and Ef1a/IRESTagsmCherryAvailable SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAdEasy-1
Plasmid#16400PurposeAdenoviral vector for use in AdEasy System.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseAdenoviralExpressionMammalianAvailable SinceJune 11, 2008AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-hifiDn29-dCas9-P2A-GFP
Plasmid#247158PurposeMammalian expression of a human codon optimized engineered hifiDn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInserthifiDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503N/I98V…PromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV1)
Viral Prep#59462-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV9)
Viral Prep#59171-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-2xCL-YFP-Vpr
Plasmid#105215PurposeBi-functional Fluorescent reporter protein to visualize HIV-1 fusion and core-traffickingDepositorInsertVpr
TagsPC2x (SQNY/IRKVL), eYFP, and mCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
rtTA-N144
Plasmid#66810Purpose2nd generation lentiviral transfer plasmid. Expresses the reverse tetracycline-controlled transactivator (rtTA) with hygromycin resistanceDepositorInsertReverse tetracycline-controlled transactivator
UseLentiviralExpressionMammalianPromoterHuman EF1aAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
c-myc-PT3EF1a
Plasmid#92046PurposeExpresses c-Myc in mammalian cellsDepositorAvailable SinceJuly 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcVpx.myc
Plasmid#213388PurposeGenerate lentiviral vector which increases gene delivery into primary human myeloid cellsDepositorInsertSIVmac vpx (vpx Simian Immunodeficiency Virus)
UseLentiviralTagsmyc-6xHisExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry
Plasmid#176016PurposeMammalian expression of mCherry. Parton lab clone DFQDepositorInsertmCherry
ExpressionMammalianAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSIRV-NFAT-eGFP
Plasmid#118031PurposeFluorescent reporter for NFAT activationDepositorInserteGFP
UseRetroviralPromoterminimal promoter with NFAT binding siteAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgRNA
Plasmid#124844PurposeVector for Cre-dependent expression of SaCas9DepositorInsertSaCas9, gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingTagsNLS and NLS-3xHAAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (AAV5)
Viral Prep#62723-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] (#62723). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] plasmid DNA. Cre-dependent ChrimsonR-tdTomato under the control of the Synapsin promoter. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomato (Cre-dependent)Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only