We narrowed to 9,217 results for: sgRNA
-
Plasmid#159174PurposeVector B encodes pAAV-pMecp2-dSaCas9-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of dSaCas9-sgRNA in neuronsDepositorInsertdSaCas9
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available sinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0089
Plasmid#117565PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting {AT1G68250} in A. thalianaDepositorInsertPromoter_AtU6-26 + sgRNA_{AT1G68250} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA1
Plasmid#164932PurposeExpresses EGFP sgRNA1 in mammalian cellsDepositorInsertsgRNA1 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_TOP1
Plasmid#68423PurposeTransient expression of the "TOP1" construct, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTOP1 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-MS2
Plasmid#235597PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. The cloning site is BsmbI.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Jun lab tunable CRISPRi strain
Bacterial strain#86400PurposeStrain SJ_XTL219 Genotype: MG1655 PBAD_dcas9 ΔlacI ΔaraE araFGH<>spec lacY A177C, galM<pBBa-J23119-tet-sacB-handle-termDepositorBacterial resistanceSpectinomycin and hygromycinAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.CYRANO
Plasmid#128755PurposeExpresses CYRANO gRNA for CRISPRiDepositorAvailable sinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDD427
Plasmid#202080PurposeFrame +2/-1 selector for NHEJ knock-inDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertpEF1a-mCherry-Cas9 + Frame +2/-1 sgRNA
UseCRISPRPromoterEF1aAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBM019
Plasmid#128179PurposeConstruct for generating stable Cas9-expressing Toxoplasma gondiiDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertssgRNA#1
SpCas9
Chloramphenicol acetyltransferase
UseCRISPR; Toxoplasma gondii expressionTags3X FLAG and Nuclear Localization SignalPromoterTUB1 (Toxoplasma gondii), U6 (Toxoplasma gondii),…Available sinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_5
Plasmid#163455Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 5 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-CD4
Plasmid#136938PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human CD4; induce CD4+ deletion rearrangement by pairing w/ px330-GAPDHDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting CD4 (CD4 Human)
UseCRISPRExpressionMammalianAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLQ5004_hU6_sgRNA targeting e7
Plasmid#190687PurposesgRNA targeting enhancer 7 of MYCDepositorInsertsgRNA targeting enhancer 7 of MYC
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianPromoterHuman U6 promoterAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0114
Plasmid#117553PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting NbPDS gene in N. benthamianaDepositorInsertPromoter_AtU6-26 + sgRNA_NbPDS1 N. benthamiana
ExpressionPlantPromoterAt U6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro-PJY390
Plasmid#251159PurposeCloning backbone for guide RNAs compatible with 10x FLEXDepositorInsertSpCas9 sgRNA F+E
UseCRISPR and LentiviralPromoterEF1aAvailable sinceJune 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg2
Plasmid#244870PurposeKnockout of human SLC31A1DepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg1
Plasmid#244869PurposeKnockout of human SLC31A1DepositorAvailable sinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only