We narrowed to 10,054 results for: aav
-
Plasmid#125918PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA35Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
105_pAAV-ProC16-CatCh-GFP-WPRE
Plasmid#125951PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC16Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
216_pAAV-ProD24-CatCh-GFP-WPRE
Plasmid#126000PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD24Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnj6
Plasmid#159913PurposeMutagenesis of Kcnj6DepositorInsertKcnj6 (Kcnj6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
27_pAAV-ProB12-CatCh-GFP-WPRE
Plasmid#125932PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB12Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
131_pAAV-ProB13-CatCh-GFP-WPRE
Plasmid#125933PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB13Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
55_pAAV-ProA13-CatCh-GFP-WPRE
Plasmid#125896PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA13Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger1-TS-YFP)
Plasmid#127245PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger1) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger1-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger3-TS-YFP)
Plasmid#127242PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ChromeQ-GFP]
Plasmid#153540PurposeAAV-mediated expression of ChromeQ-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-SwiChR-eYFP
Plasmid#166604PurposeEncodes Cre-dependent SwiChR-eYFP under control of the TREDepositorInsertSwiChR-eYFP
UseAAVPromotertetracycline response elementAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-FLEX-rc [SomArchon-GFP]
Plasmid#153532PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-NEO-CAG-BFP-pA-GFP-pA
Plasmid#149344PurposeVector for targeting the Replace reporter to the AAVS1 locusDepositorInsertBFP
ExpressionMammalianPromoterCAGAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321E
Plasmid#115343PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321EDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-Mac-GFP
Plasmid#58803PurposeAAV-mediated expression of Mac-GFP under the CAG promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertMac-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterCAGAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
40_pAAV-ProC9-CatCh-GFP-WPRE
Plasmid#125944PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC9Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
95_pAAV-ProA28-CatCh-GFP-WPRE
Plasmid#125911PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA28Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
61_pAAV-ProA18-CatCh-GFP-WPRE
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CW3SL-Myr-mCherry-Dr-TrkA
Plasmid#127962PurposeMyr mCherry DrTrkA expression under CAMK promoterDepositorInsertmCherry DrTrkA
UseAAVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1⍺-DIO-Cx34.7-M1-mEmerald
Plasmid#255634PurposeEncodes M. americana Cx34.7, codon optimized for mouse expression, with 8 amino acid linker and c-terminally fused mEmerald tag. Mutations of E214K and E223K. Expression driven by EF1a promoter.DepositorInsertCx34.7
UseAAVTagsmEmeraldMutationE214K,E223KPromoterEF1aAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-CAG-Flex-Quetzal-S-WPRE
Plasmid#253389PurposeCre-dependent whole-cell expression of GCaMP8m-mScarlet fused via a rigid covalent linkerDepositorInsertQuetzal-S
UseAAVExpressionMammalianAvailable SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Quetzal-S-LA-WPRE
Plasmid#253388PurposeEnhanced dendritic spine (via LifeAct) localization of a Cre-dependent GCaMP8m-mScarlet fusion with a rigid covalent linkerDepositorInsertQuetzal-S-LA
UseAAVExpressionMammalianAvailable SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-Quetzal-Cy-WPRE
Plasmid#253387PurposeCre-dependent whole-cell expression of GCaMP8m-mCyRFP1 fused via a rigid covalent linkerDepositorInsertQuetzal-Cy
UseAAVExpressionMammalianAvailable SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSaCas9-KRAB(Zim3)-pA
Plasmid#255030PurposeAAV plasmid encoding a dSaCas9-KRAB(Zim3) fusion gene controlled by a CMV promoterDepositorInsertdSaCas9-KRAB(Zim3)
UseAAV and CRISPRAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-BiSSTe4-dSaCa9-KRAB(Zim3)-pA
Plasmid#255031PurposeAAV plasmid encoding a dSaCas9-KRAB(Zim3) fusion gene controlled from an SST-specific neuronal enhancer, BiSSTe4DepositorInsertdSaCas9-KRAB(Zim3)
UseAAV and CRISPRAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-L-mRuby-Pro-EGFP-4×19
Plasmid#218264PurposeExpresses EGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiRL-mRuby-EF1a-CMVe_MeP-EGFP-MREL_4×19
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synmiR-7-mRuby-Pro-EGFP-8×12
Plasmid#218253PurposeExpresses EGFP in mammalian cells regulated by a synthetic microRNA-based dosage compensation circuitDepositorInsertsynPolyA-synmiR7-mRuby-EF1a-CMVe_MeP-EGFP-MRE7_8×12
UseAAV and Synthetic BiologyExpressionMammalianAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-Quetzal-Cy-WPRE
Plasmid#253385PurposeWhole-cell expression of GCaMP8m-mCyRFP1 fused via a rigid covalent linkerDepositorInsertQuetzal-Cy
UseAAVExpressionMammalianAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-Quetzal-S-WPRE
Plasmid#253386PurposeWhole-cell expression of GCaMP8m-mScarlet fused via a rigid covalent linkerDepositorInsertQuetzal-S
UseAAVExpressionMammalianAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI3hyp-Kv-WPRE
Plasmid#246629PurposeDouble floxed soma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI3hyp in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInsertJEDI3hyp-Kv
UseAAV and Cre/LoxTagsKvExpressionMammalianPromoterEF1aAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-JEDI3hyp-WPRE
Plasmid#246633PurposeFlp dependent genetically encoded voltage indicator (GEVI) JEDI3hyp in an AAV production vector under the control of the mammalian promoter (EF1a)DepositorInsertJEDI3hyp
UseAAV; Flp recombinaseExpressionMammalianPromoterEF1aAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-JEDI3sub-WPRE
Plasmid#246620PurposeFlp dependent genetically encoded voltage indicator (GEVI) JEDI3sub in an AAV production vector under the control of the mammalian promoter (EF1a)DepositorInsertJEDI3sub
UseAAV; Flp recombinaseExpressionMammalianPromoterEF1aAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dTomato-Fb(LAG16)-RiboL1
Plasmid#249315PurposedTomato-Fb(LAG16) expression in mammalian cells. pAAV vector.DepositorInsertdTomato-Fb(LAG16)
UseAAVPromoterhSynAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only