We narrowed to 7,293 results for: GFP expression plasmids
-
Plasmid#172748PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-19; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-19
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-3
Plasmid#172740PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-3; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-3
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-12
Plasmid#172744PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-12; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-12
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-14
Plasmid#172745PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-14; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-14
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAID5.4-N
Plasmid#145814PurposeAn all-in-one bicistronic plasmid for controlling protein degradation by AID technologyDepositorTypeEmpty backboneTagsmAID-EGFPExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID5.4-C
Plasmid#145815PurposeAn all-in-one bicistronic plasmid for controlling protein degradation by AID technologyDepositorTypeEmpty backboneTagsmAID-EGFPExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWT004a
Plasmid#107883PurposeR1 plasmid. Contains PBAD-EGFP and is part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP
ExpressionBacterialAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT018a
Plasmid#107885PurposeR3 plasmid. Contains PBAD-EGFP and is part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP
ExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAID5.2-N
Plasmid#145810PurposeAn all-in-one bicistronic plasmid for controlling protein degradation by AID technologyDepositorTypeEmpty backboneTagsmAID-EGFPExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID5.2-C
Plasmid#145811PurposeAn all-in-one bicistronic plasmid for controlling protein degradation by AID technologyDepositorTypeEmpty backboneTagsmAID-EGFPExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMAT_CD28ICD
Plasmid#197098PurposeThis plasmid contains the coding sequence for the intracellular domain of CD28. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of CD28.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G12-CheRiff-T2A-mCherry
Plasmid#170275PurposeCheRiff-T2A-mCherry construct expression in mammlian cells. pAAV vector. Reporter plasmid.DepositorInsertCheRiff-T2A-mCherry
UseAAVPromoter11xUAS with TATA-box minimal promoterAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSynITR_DD
Plasmid#253227PurposeThis is a DD-ITR AAV Production plasmid that contains the SynITR sequence as published in PMID: 39868534DepositorInsertsEnhanced Green Fluorescent Protein
SynITR
UseAAVExpressionMammalianAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pWT009d
Plasmid#107888PurposeR6 plasmid. Contains PBAD-EGFP and is part of part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP
ExpressionBacterialAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT018e
Plasmid#107886PurposeR4 plasmid. Contains PBAD-EGFP-151TGA and is part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP-151TGA
ExpressionBacterialAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWT004b
Plasmid#107884PurposeR2 plasmid. Contains PBAD-EGFP-151TGA and is part of the CAMERA system for rewritable multi-event analog recording in bacteriaDepositorInsertPBAD-EGFP-151TGA
ExpressionBacterialAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pED17x11
Plasmid#134814PurposesfGFP expression plasmid for characterizing qtRNA chargingDepositorInsertsfGFP-151-TAGA
UseSynthetic BiologyTags6xHisExpressionBacterialMutation151-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM7067
Plasmid#214005PurposePrpsM driven expression of ssrA-tagged eGFP (AAV)DepositorInserteGFP-AAV
ExpressionBacterialPromoterPrpsMAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIA10.7
Plasmid#214451PurposeBxbI landing-pad Tet-On-T2A-puro-pA pA-GFP-TRE3G donor. Use with BxbI expressing plasmid to swap payload into 4.721 landing-pad. Generates inducible cell line.DepositorInsertsTet-On 3G
PuroR
TRE3G CopGFP
UseBxbi donorTagsPuroR, T2A, and Tet-On 3GAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT2
Plasmid#127512PurposePlasmid encodes H. sapiens codon optimized Integrase 2.DepositorInsertIntegrase 2 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT9
Plasmid#127516PurposePlasmid encodes H. sapiens codon optimized Integrase 9.DepositorInsertIntegrase 9 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT13
Plasmid#127517PurposePlasmid encodes H. sapiens codon optimized Integrase 13.DepositorInsertIntegrase 13 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ889
Plasmid#84826PurposeMinimos transposon with Psmu-1:smu-1:GFP:smu-1 UTR and cbr-unc-119 selectionDepositorAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR del52-linker-Venus-KDEL
Plasmid#214786PurposeMammalian expression of human del52-linker-Venus-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR ins5-linker-Venus-KDEL
Plasmid#214787PurposeMammalian expression of human CALR ins5-linker-Venus-KDELDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR del52-linker-Venus
Plasmid#214788PurposeMammalian expression of human CALR del52-linker-VenusDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV/CALR ins5-linker-Venus
Plasmid#214789PurposeMammalian expression of human CALR ins5 -linker-VenusDepositorAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-MRTFA-HA
Plasmid#247436PurposesiRNA resistant HA-tagged mouse MRTF-A cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationsiRNA resistant - no amino acid mutationsAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-Rho(G14V)-HA
Plasmid#247437PurposeHA-tagged human RhoA(G14V) cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianMutationG14V mutation (constitutive active mutant)Available SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-CDK1-HA
Plasmid#247438PurposeHA-tagged mouse CDK1 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-CKS2-HA
Plasmid#247439PurposeHA-tagged mouse CKS2 cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-Myoferlin-HA
Plasmid#247440PurposeHA-tagged human Myoferlin cloned into the pCW backbone (Addgene #41393, with puromycin resistance) together with an IRES GFP to indicate doxycycline-inducible expression by fluorescence.DepositorInsertsUseLentiviral; Dox-inducibleTagsHAExpressionMammalianAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT4
Plasmid#127513PurposePlasmid encodes H. sapiens codon optimized Integrase 4.DepositorInsertIntegrase 4 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINT5
Plasmid#127514PurposePlasmid encodes H. sapiens codon optimized Integrase 5.DepositorInsertIntegrase 5 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AP682-1
Plasmid#70050PurposeExpresses TEV::eGFP::myc::3Xflag in bacteriaDepositorInserteGFP
TagsTEV and myc::3XflagExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBA2675
Plasmid#189997PurposeInducible expression of FBP75 (1–200)-NLS-VhhGFP4, integrate at 177 bp, phleomycin marker (deGradFP for nuclear proteins)DepositorInsertsFBP75
VhhGFP4
UseExpression vector for trypanosoma bruceiTagsNLSMutationN-terminal 600 bp of FBP75Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA2705
Plasmid#189998PurposeInducible expression of FBP75(1–200)-VhhGFP4, integrate at 177 bp, phleomycin marker (deGradFP for cytoplasmic proteins)DepositorInsertsFBP75
VhhGFP4
UseExpression vector for trypanosoma bruceiMutationN-terminal 600 bp of FBP75Available SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEMS1424
Plasmid#29220PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertPle155-EGFP-NLS
UseHigh copy number homologous recombination plasmid…ExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pKM493
Plasmid#140191PurposeORBIT integrating plasmid for C-terminal tagging with cleavable EGFP.DepositorInsertTEV-Flag-Gly4-eGFP
TagsFlag + eGFPExpressionBacterialPromoterPGroELAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM162
Plasmid#173221PurposeExpresses ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP(1-9)-GB1 and Puro-T2A-MCP-mCherry-GFP11-GB1DepositorInsertsScFV-GCN4-GFP10M2-GB1-T2A-OptGFP (1-10)-GB1
MCP-mCherry-GFP11-GB1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBD21_035
Plasmid#109152PurposepL2 plasmid backbone for assembly of a transcription unit along with constitutive expression of EGFPDepositorInsertsmRFP
EGFP
UseSynthetic BiologyExpressionBacterial and MammalianPromoterCMV and pTetAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free NES (M)
Plasmid#182437PurposeYeast integrative plasmid for expressing ERG20(F96W-N127W) (GAL10 promoter) and AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS(M)
NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAT_41BBICD
Plasmid#197097PurposeThis plasmid contains the coding sequence for the intracellular domain of 4-1BB. Digest this insert and add it to pHR_pSFFV_scFVCD19_CD8a_CD3zP2AEGFPDepositorInsertThis plasmid contains the coding sequence for the intracellular domain of 4-1BB.
ExpressionMammalianAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Antares2
Plasmid#120868PurposePiggybac transposon plasmid for live animal optical imagingDepositorInsertpcDNA3-Antares2
ExpressionMammalianMutationAntares2 ampliconPromoterCAG PromoterAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
rAAV-CAG::FLEX-rev:ChR2HA:2a:PSAML141F,Y115F:GlyR
Plasmid#32483PurposeCre-dependent expression of ChR2 and PSAM-GlyR (L141F,Y115F) neuronal inhibitor, with IRES-EGFP markerDepositorInsertChR2HA-2a-PSAML141F,Y115F:GlyR
UseAAV and Cre/Lox; Adeno-associated virus, flex swi…TagsChR2 2APromoterCAGAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP973-1
Plasmid#99496PurposeTEV::linker::meGFP:3XFlagDepositorInsertTEV::linker::meGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP758-1
Plasmid#99494PurposeTEV::eGFP::3XFlagDepositorInsertTEV::eGFP::3XFlag
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only