We narrowed to 165,918 results for: addgene
-
Plasmid#62439PurposeMXS_chaining vector with CMV::PuroR-bGHpADepositorInsertresistance cassette against Puromycin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNR64
Plasmid#79540PurposeInput plasmid: expresses two recombinases downstream of two inducible promoters. Same as Dual-Recombinase-Controller (plasmid #44456) from Endy Lab except with KanR instead of CamR on the backbone.DepositorInsertsTP901
BxbI
TagsHis tag and LAA degradation tagExpressionBacterialAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL1P5 ZmUbiP:GRF-GIF:NosT
Plasmid#198046PurposeMoClo Golden Gate Level 1 Position 5. Overexpression cassette of Growth-Regulating Factor 4 (GRF4) plus GRF-Interacting Factor 1 (GRF4-GIF1). Improves in vitro wheat regeneration and transformation.InsertZmUbiP::TaGRF4-GIF1::NosT
UseSynthetic BiologyPromoterZea mays (maize) ubiquitin promoterAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIgnaviCas9
Plasmid#127595PurposeExpresses IgnaviCas9 in E. coliDepositorInsertIgnaviCas9
Tags6xHis Tag and Maltose binding proteinExpressionBacterialPromoterT7 promoterAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHPyV7-713a
Plasmid#24728DepositorInsertFull genome of Human polyomavirus 7
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
ICP8-P2A/Crimson (pSLIK4)
Plasmid#113859PurposeFor Doxycycline-inducible expression of ICP8 synaptase gene, with ICP8-P2A-red fluorescent protein gene E2-CrimsonDepositorInsertICP8
UseLentiviralTagsP2A/CrimsonAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBEVY-T
Plasmid#51232Purposebi-directional expression vector for yeast, constitutively active, TRP1 selectionDepositorTypeEmpty backboneExpressionYeastPromoterGPD/ADH1Available SinceMarch 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHPyV6-607a
Plasmid#24727DepositorInsertFull genome of Human polyomavirus 6
UseViral cloneAvailable SinceJune 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDB4280
Plasmid#98699PurposeA Cas9-encoding plasmid containing the 5' portion of the ura4 marker and the rrk1 promoter/leader. When linearized by NotI, it serves as the gapped vector in the split-ura4 systemDepositorInsertCas9
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
p184_LTJ_sgRNACD90.2
Plasmid#82670PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUG+p97W (C2)
Plasmid#74018Purposelentiviral expression of EGFP-SAP97beta fusionDepositorInsertSAP97 beta isoform
UseLentiviralTagsEGFPExpressionMammalianPromoterhUbCAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiMutB3GNT5-blast
Plasmid#208380Purposelentiviral vector for expressing human B3GNT5 with C-terminal myc-DDK tag, includes nucleotide change in PAM targeting sequenceDepositorInsertBeta-1,3-N-Acetylglucosaminyltransferase 5 (B3GNT5 Human)
UseLentiviralTagsmyc, FLAGExpressionMammalianMutationnt 922 c->g (PAM site inactivation)PromoterEF-1 alpha core promoterAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB4281
Plasmid#98700PurposeA Cas9-encoding plasmid containing the 5' portion of the bsdMX marker and the rrk1 promoter/leader. When linearized by NotI, it serves as the gapped vector in the split-bsdMX systemDepositorInsertCas9
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-LSD1-K661A-Hygro
Plasmid#104414Purposetransient expression of dCas9-dLSD1 fusion proteinDepositorInsertdLSD1 (KDM1A Human)
UseCRISPRExpressionMammalianMutationIRATp970A0364D (Source Bioscience) has a P405H ch…PromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATG5 sgRNA
Plasmid#207555PurposepX330 expressing Cas9 and a sgRNA targeting the ATG5 locusDepositorInsertAACTTGTTTCACGCTATATC
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-PCYT2
Plasmid#81074PurposeExpresses PCYT2 in mammalian cellsDepositorInsertphosphate cytidylyltransferase 2, ethanolamine (PCYT2 Human)
UseLentiviralTagsFLAGExpressionMammalianAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only