We narrowed to 7,838 results for: aav
-
Plasmid#135639PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E4 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E10-dTom-nlsdTom
Plasmid#135645PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E10 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVTagsExpressionMutationNonePromoterAvailable sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mIsl2-EGPF
Plasmid#153191PurposeMouse Isl2 (mIsl2) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP6f-P2A-Vmn1r85
Plasmid#133414PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 85DepositorInsertGCaMP6f-P2A-vmn1r78 (Vmn1r78 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-GCaMP5g-P2A-Vmn1r89
Plasmid#133416PurposeFluorescent calcium reporter and mouse vomeronasal 1 receptor 89DepositorInsertGCaMP5g-P2A-PAmCherry-Vmn1r89 (Vmn1r89 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p-AAV2-hSyn-MerMAID1-Citrine
Plasmid#126520PurposeAnion-conducting Channelrhodopsin with near-complete desensitization in continuous light. Codon-optimized for mammalian expression (human/mouse).DepositorInsertMerMAID1
UseAAVTagsCitrineExpressionMutationPromoterhuman synapsinAvailable sinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
VII_pAAV-ProB8-GFP-WPRE
Plasmid#125928PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGFP
UseAAVTagsExpressionMutationPromoterProB8Available sinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV RhoB YFP MS2
Plasmid#131777PurposeRhoB upstream msfYFP 24xMS2 RhoB downstream for CRISPR taggingDepositorInsertmsfYFP - 24x MS2 loops
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Btg2 YFP MS2
Plasmid#131776PurposeBtg2 upstream msfYFP 24xMS2 Btg2 downstream for CRISPR taggingDepositorInsertmsfYFP - 24x MS2 loops
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeT-GFP
Plasmid#123316PurposeAAV-mediated expression of ChromeT-GFP under the Syn promoter.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFP
Plasmid#121509PurposeExpresses sgRNA targeting mouse Fah intron 9 (sgFah.Intron9).DepositorInsertsgFah.intron9
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAav-IQGAP1-PQS1-3xFLAG
Plasmid#84885PurposerAAV-based template for genome engineering of the IQGAP1 C-terminus containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertsUseAAVTagsPQS1 3xFLAGExpressionMutationPromoternoAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-PQS1-3xFLAG
Plasmid#84884PurposerAAV-based template for genome engineering of the p53 C-terminus containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertsUseAAVTagsPQS1 3xFLAGExpressionMutationPromoterno and noAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iGluSnFR4s-NGR-WPRE
Plasmid#234451PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAVTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterCAGAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cre-P2A-dTomato
Plasmid#107738PurposeCan be used to express Cre recombinase and simultaneously the red fluorescent protein dTomato. Can also be used to create adeno-associated virus for delivery of these genes.DepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertCre, dTomato
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterhSynAvailable sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX-mScarlet-WPRE
Plasmid#99280PurposeCan be used to generate AAV virus that will express mScarlet in the presence of CreDepositorInsertmScarlet
UseAAV and Cre/LoxTagsExpressionMutationPromoterAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only