We narrowed to 7,091 results for: plasmid dna
-
Plasmid#87348PurposeD435C/E945C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, lobe closure FRET constructDepositorInsertCas9
TagsHis-MBPExpressionBacterialMutationC80S/D435C/C574S/E945CPromoterT7Available SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_TALEN-FokI(WT)-BB_V3
Plasmid#42588DepositorInsertTALEN-FokI(WT)-BB
UseAAV; Adeno-associated virus ()Tags3XFlagExpressionMammalianPromoterCAG hybridAvailable SinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSHS248
Plasmid#87354PurposeS867C/N1054C in cysteine-free (C80S/C574S) S. pyogenes Cas9 expression plasmid, HNH-2 FRET constructDepositorInsertCas9
TagsHis-MBPExpressionBacterialMutationC80S/C574S/S867C/N1054CPromoterT7Available SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
BSP607
Plasmid#122252Purposeexpression vector for mKO2 under EFT3 promoterDepositorInsertmKO2
ExpressionWormPromoterEFT3Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMulti-sgRNA-LacZ
Plasmid#99913PurposeReceptor plasmid for the assembly of multiple sgRNAsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
BSP602
Plasmid#122249Purposeexpression vector for mScarlet under EFT3 PromoterDepositorInsertmScarlet
UseSynthetic BiologyExpressionWormPromoterEFT3Available SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDHJS3 AN-
Plasmid#78241PurposeOne of four plasmids needed to create the mismatched double Holliday junction substrate (MM-DHJS).DepositorInsertsloxP
sequence "A" with NheI site
loxP2
Available SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDHJS3 AS-
Plasmid#78237PurposeOne of four plasmids needed to create the double Holliday junction substrate (DHJS).DepositorInsertsloxP
sequence "B"
loxP2
UsePhagemidAvailable SinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only