We narrowed to 2,684 results for: GCG
-
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::axed{sgRNA})
Plasmid#187883PurposeGal4/UAS sgRNA expression targeting axedDepositorInsert4 sgRNAs targeting axed
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS-4x(tRNA::dsarm{sgRNA})
Plasmid#187885PurposeGal4/UAS sgRNA expression targeting dsarmDepositorInsert4 sgRNAs targeting dSarm
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056H
Plasmid#183135PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056J
Plasmid#183136PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii sxl, and 1 gRNA targeting D.suzukii bTub,Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[sxl, bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
RRM2 E3.3 gRNA
Plasmid#90882Purpose3rd generation lentiviral gRNA plasmid targeting human RRM2DepositorInsertRRM2 (Guide Designation E3.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
PBLO CasX-gRNA
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionAvailable SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_1
Plasmid#86358PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBW1997_pExpr-hU6-CRISPR-DECODER
Plasmid#87549PurposeExpresses NGN2, MIAT, ACTC1, and TTN gRNAs in response to combinations of Cre and Flp recombinasesDepositorInsertgRNAs targeting NGN2, MIAT, ACTC1, TTN
UseCRISPR, Cre/Lox, and Synthetic BiologyExpressionMammalianAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpb_v1-hu6-sgCebpd_v1
Plasmid#177255PurposeExpresses Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpb_v1/sgCebpd_v1
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v1-mU6-sgCebpb_v1-hU6-sgCebpd_v1
Plasmid#177257PurposeExpresses Cebpa_v1 (bU6), Cebpb_v1 (mU6), Cebpd_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1/sgCebpd_v1
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7535 pHR (hU6-crSURF2-EFS-PuroR-WPRE)
Plasmid#214879PurposeLentiviral vector encoding RfxCas13d targeting SURF2 guide arrayDepositorInserthU6-crSURF2-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Yap1-E1-#1
Plasmid#171517Purposedeletion of a genomic locus in Yap1 geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG198
Plasmid#165605PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with two hEGFP protospacers: PS1(upstream of promoter with 'CAGCG' PAM)-lac-PS2(downstream with 'CGGCG' PAM)-HIS3 and GFPDepositorInserthEGFP protospacer ('CGGCG' PAM) downstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutationSecondary protospacer ('CGGCG' PAM) ins…PromoterlacAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAPK11 gRNA (BRDN0001146070)
Plasmid#77483Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only