We narrowed to 9,000 results for: sgRNA
-
Plasmid#136376PurposeGateway entry clone for AaCas12b sgRNA expression under ZmUbi promoter with ribozyme processing; sgRNA scaffold 3.8 is usedDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLenti CRISPR V2 sgMTFMT_1
Plasmid#106318PurposeExpress Cas9 and sgRNA targeting MTFMTDepositorInsertsgRNA targeting MTFMT
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No4
Plasmid#194899PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-4 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.4
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1
Plasmid#98976PurposeCas9 Homologous Recombination Reporter. SpCas9N863A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 44bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 1 and Cas9(N863A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_1
Plasmid#106306PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgMTHFD2L_2
Plasmid#106307PurposeExpress Cas9 and sgRNA targeting MTHFD2LDepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT1_2
Plasmid#106312PurposeExpress Cas9 and sgRNA targeting SHMT1DepositorInsertsgRNA targeting SHMT1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAT-9222
Plasmid#124222PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-sDepositorInsertself-targeting gRNA between EGFP halves
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgShmt2_2
Plasmid#106315PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorInsertsgRNA targeting mShmt2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT2_2
Plasmid#106310PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
APq5210
Plasmid#66086Purposeco-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORFDepositorInsertsgRNA for APa4-2
UseCRISPRExpressionWormPromoterU6Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-U6gRNA2-Filler
Plasmid#237401PurposeFor the sequential insertion of two guide RNAs into two U6gRNA cassettes.DepositorInsertsU6gRNA-1
U6gRNA-2
PGK-TagBFP
UseCRISPR and RetroviralExpressionMammalianPromoterPGK promoter, U6 promoter, and U6, PGKAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only