We narrowed to 26,111 results for: sta
-
Plasmid#23102DepositorInsertBim EL (TD) (Bcl2l11 Mouse)
TagsGstExpressionBacterialMutationChanged Threonine 112 to AspartateAvailable SinceFeb. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHIS2-hsSTAM1 (1-143)
Plasmid#21498DepositorAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSEM237 - pEXP[Prpl-3 | histamine | rpl-3 UTR]
Plasmid#159796PurposeHistamine based negative selection marker to paralyze animals with arraysDepositorInsertpEXP[Prpl-3 | histamine | rpl-3 UTR]
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
2xMyc-tdMCP-SNAP (tdMCP standard)
Plasmid#226166PurposeFor transient expression of the tdMCP-protein standard. Used in LABEL-seq abundance assays.DepositorInsert2xMyc-tdMCP-SNAPtag
UseLentiviralTags2xMyc-tdMCP and EGFP-IRES-BlastRExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
siRNA-resistant pLV-SigmaR1-mNeonGreen
Plasmid#226569PurposeEncodes siRNA resistant SigmaR1 protein labeled with mNeonGreen (lentiviral vector)DepositorAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-MBP-HsStaufen1-T2_V
Plasmid#147743PurposeMammalian Expression of HsStaufen1-T2DepositorInsertHsStaufen1-T2 (STAU1 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-MBP-HsStaufen1-T3_V
Plasmid#147744PurposeMammalian Expression of HsStaufen1-T3DepositorInsertHsStaufen1-T3 (STAU1 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-STAT5A-DN-CMV-GFP
Plasmid#83252PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFPDepositorInsertsUseAdenoviralMutationC-terminal deletion of 135 nucleotides (dominant …PromoterCMVAvailable SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_SV40
Plasmid#99310PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_CMV
Plasmid#99314PurposeLuciferase validation vector with CMV enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertCMV enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGSTag Flag Jnk3a1(2nd methione)
Plasmid#15746DepositorInsertJnk3a1-2nd M (MAPK10 Human)
ExpressionBacterialAvailable SinceMarch 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
XLone-eGFP NLS (no drug resistant gene)
Plasmid#140032PurposeTunable and temporal expression control of eGFP (or gene of interest) with constitutive nuclear eGFPDepositorInsertEnhanced Green Fluorescent Protein
UseSynthetic BiologyExpressionMammalianPromoterTRE3GAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LO601: pMVP (R4-R3) destabilized firefly luciferase (Luc2P)
Plasmid#132926PurposepMVP R4-R3 entry plasmid, contains destabilized Firefly Luciferase (Luc2P) for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertLuc2P
UseGateway Cloning, Luciferase, and Synthetic Biolog…TagsPEST destabilization domainAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2 8xSTAR-mScarletI-NLS. PGK-puro
Plasmid#136263PurposeFluorescent reporter for intestinal stem cells through ASCL2 transcriptional activityDepositorInsertstem cell Ascl2 reporter, 8 repeats
UseTol2 transposaseTagsmScarletI-NLSExpressionMammalianAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-hFX-promotor(2kb, distal)
Plasmid#14981DepositorInserthuman frataxin promoter fragment (FXN Human)
UseLuciferaseMutationincludes distal fragment of human frataxin promot…Available SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET His6 Gamma crystallin TEV LIC cloning vector (2X-T)
Plasmid#29714DepositorTypeEmpty backboneTagsHis6-Gamma crystallin-TEVExpressionBacterialAvailable SinceJune 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pALPS_3'LTR GFP@gag start SFFV-
Plasmid#101337PurposeRepaired U3 allows LTR-based transcription by the provirus with GFP as a marker for expression. WPRE was deleted.DepositorInsertGFP
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-STAT5A-DNL-CMV-GFP
Plasmid#83253PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFPDepositorInsertsUseAdenoviralMutationC-terminal deletion of 351 nucleotides (dominant …PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
JI401: Ad5 E1A/Hexon qRT-PCR standard
Plasmid#131753PurposePlasmid standard containing regions of the Ad5 E1A and Ad5 Hexon genes to create a qRT-PCR standard curve for detection of replication competent adenovirus (RCA).DepositorInsertsAd5 E1A gene fragment
Ad5 Hexon gene fragment
UseStandard for qrt-pcrPromoterN/AAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only