We narrowed to 21,811 results for: SPR
-
Plasmid#82706PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBUN6I11
Plasmid#50580PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…PromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRDA_221
Plasmid#169142PurposeConstitutive expression of EGFP and sgRNAs targeted to EGFP for measurement of activity of AsCas12a\EnAsCas12a.DepositorInsertEGFP , EGFP sgRNA
UseCRISPR and LentiviralAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
BPK2014-AaCas12b
Plasmid#121949PurposeE. coli expression, protein purificationDepositorInsertAaCas12b
Tags10xHis tagExpressionBacterialAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B
Plasmid#69283PurposeGolden Gate entry vector; 3rd gRNA under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceSept. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GFP-MHC-IIB
Plasmid#35691DepositorAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-CMV-FLEX-SaCas9-U6-sgSlc32a1
Plasmid#159905PurposeMutagenesis of Slc32a1DepositorInsertSlc32a1 (Slc32a1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC0041-RanCas13b crRNA backbone
Plasmid#103852PurposeFor cloning of guide RNAs compatible with RanCas13b. Contains a 3' direct repeat. Clone using BbsI (BpiI). F overhang cacc. R overhang caac.DepositorInsertU6-RanCas13b DR-BbsI-BbsI-polyT
UseCRISPRExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
VPR-ps-dSpCas9
Plasmid#102855PurposeA single-chain light-controllable dSpCas9 with pdDronpa1.2 domainsDepositorInsertdSpCas9, pdDronpa1.2
UseCRISPR and Synthetic BiologyTagsNLS and VP64-p64-Rta transcription activatorExpressionMammalianPromoterPGKAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCYC1m_yeGFP
Plasmid#64389Purposeencodes yeast enhanced GFP under control of minimal pCYC1 promoterDepositorInsertyeast enhanced GFP
ExpressionYeastPromoterpCYC1Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-DRGFP
Plasmid#113193PurposeDR-GFP substrate (Addgene #26475) flanked by human AAVS1 homology arms. Endogenous AAVS1 promoter drives T2A-hygromycin expression after integration. DR-GFP cassette contains PGK-puromycin.DepositorInsertDR-GFP
UseDonor construct with t2a-hygromycin for gene trap…ExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
P1-EYFP-pA (Construct 5)
Plasmid#55197PurposeSynthetic promoter responsive to gRNA1DepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterMinimal Ade MLPAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-dTAG
Plasmid#207694PurposeEmpty N-terminus donor cassette. Integrate homology arms to target the N-terminus insertion of a Puro-2A-dTAG cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
U6.3>Control.gRNA.f+e
Plasmid#99140PurposeControl gRNA under the regulation of an optimized chicken specific U6 promoterDepositorInsertControl gRNA
UseCRISPRPromoterChicken U6.3Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAtC
Plasmid#78097PurposePlant expression of Cas9 and gRNA empty backbone; Basta resistanceDepositorTypeEmpty backboneUseCRISPRTagsNLS-HAExpressionPlantPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pICH41308::hCas9
Plasmid#49770PurposeLevel 0 hCas9 moduleDepositorInserthCas9
UseCRISPRAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-NLS-AcrIIA4
Plasmid#113037PurposeExpression of SV40NLS-AcrIIA4 in mammalian cells (CMV promoter driven)DepositorInsertSV40 NLS-AcrIIA4
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only