We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#163023PurposeSleeping Beauty TET-On expression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTet-OnAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBK1298-AAV-EFSNC-dCjCas9-HP1bNH(111-173)
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_LacZ_sgRNA
Plasmid#155108Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgSORCS2-G2
Plasmid#118416PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting Human SORCS2DepositorInsertgRNA SORCS2 Human (SORCS2 Human)
UseCRISPR and LentiviralAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113702PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV, CRISPR, and Mouse TargetingTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-P2A-puro
Plasmid#192131PurposeExpresses Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9
UseAAVExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.tRFP
Plasmid#57819PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9-KKH-Puro
Plasmid#135966PurposeExpresses SauriCas9-KKH and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CCND2 targeting gRNA
Plasmid#215318PurposeExpresses gRNA targeting CCND2 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND1 targeting gRNA
Plasmid#215153PurposeExpresses gRNA targeting CCND1 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTF2_KO_ex11_gRNA-4
Plasmid#131334PurposegRNA to knockout MTF2. This gRNA is also used in Haojie Li et al. Nature 2017. It targets exon 11 of MTF2.DepositorInsertMTF2_KO_ex11_gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_A
Plasmid#74376PurposegRNA_A to knockout human AMPK alpha 2 using Cas9n.DepositorAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX462-hPRKAA2-gRNA_B
Plasmid#74377PurposegRNA_B to knockout human AMPK alpha 2 using Cas9nDepositorAvailable SinceApril 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-KY-P2A-puro
Plasmid#192133PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-KY
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (K390A, Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Hsp1-Hsp2Cas9-Y-P2A-puro
Plasmid#192132PurposeExpresses highly specific Hsp1-Hsp2Cas9, cloning backbone for sgRNA and puromycin resistance geneDepositorInsertHsp1-Hsp2Cas9-Y
UseAAVExpressionMammalianMutationHsp1-Hsp2Cas9 (Y446A)Available SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
EED-KO-gRNA-2
Plasmid#131322PurposegRNA to knockout EED. Use with EED-KO-gRNA-1DepositorInsertEED-KO-gRNA-2
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-gRNA scaffold-UbC-mCherry-PuroR
Plasmid#232183PurposeLentiviral plasmid for cloning an spCas9 gRNA with puromycin resistance and mCherryDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6, hUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only